ID: 1045299440

View in Genome Browser
Species Human (GRCh38)
Location 8:100898592-100898614
Sequence GAGAGCCCTCACATTGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045299440_1045299447 24 Left 1045299440 8:100898592-100898614 CCTGGTGCAATGTGAGGGCTCTC No data
Right 1045299447 8:100898639-100898661 GGATTGTCTCACCATTTTGGAGG No data
1045299440_1045299446 21 Left 1045299440 8:100898592-100898614 CCTGGTGCAATGTGAGGGCTCTC No data
Right 1045299446 8:100898636-100898658 CAAGGATTGTCTCACCATTTTGG No data
1045299440_1045299444 3 Left 1045299440 8:100898592-100898614 CCTGGTGCAATGTGAGGGCTCTC No data
Right 1045299444 8:100898618-100898640 GGTGGGACTAAAAGCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045299440 Original CRISPR GAGAGCCCTCACATTGCACC AGG (reversed) Intergenic
No off target data available for this crispr