ID: 1045299444

View in Genome Browser
Species Human (GRCh38)
Location 8:100898618-100898640
Sequence GGTGGGACTAAAAGCCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045299433_1045299444 29 Left 1045299433 8:100898566-100898588 CCTTGTCCTGGATTCACTGTTTG No data
Right 1045299444 8:100898618-100898640 GGTGGGACTAAAAGCCTTCAAGG No data
1045299440_1045299444 3 Left 1045299440 8:100898592-100898614 CCTGGTGCAATGTGAGGGCTCTC No data
Right 1045299444 8:100898618-100898640 GGTGGGACTAAAAGCCTTCAAGG No data
1045299439_1045299444 4 Left 1045299439 8:100898591-100898613 CCCTGGTGCAATGTGAGGGCTCT No data
Right 1045299444 8:100898618-100898640 GGTGGGACTAAAAGCCTTCAAGG No data
1045299435_1045299444 23 Left 1045299435 8:100898572-100898594 CCTGGATTCACTGTTTGGTCCCT No data
Right 1045299444 8:100898618-100898640 GGTGGGACTAAAAGCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045299444 Original CRISPR GGTGGGACTAAAAGCCTTCA AGG Intergenic
No off target data available for this crispr