ID: 1045299446

View in Genome Browser
Species Human (GRCh38)
Location 8:100898636-100898658
Sequence CAAGGATTGTCTCACCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045299439_1045299446 22 Left 1045299439 8:100898591-100898613 CCCTGGTGCAATGTGAGGGCTCT No data
Right 1045299446 8:100898636-100898658 CAAGGATTGTCTCACCATTTTGG No data
1045299440_1045299446 21 Left 1045299440 8:100898592-100898614 CCTGGTGCAATGTGAGGGCTCTC No data
Right 1045299446 8:100898636-100898658 CAAGGATTGTCTCACCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045299446 Original CRISPR CAAGGATTGTCTCACCATTT TGG Intergenic
No off target data available for this crispr