ID: 1045300623

View in Genome Browser
Species Human (GRCh38)
Location 8:100907524-100907546
Sequence CCTCACATGCAGCAGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045300623_1045300628 24 Left 1045300623 8:100907524-100907546 CCAGGCACCTGCTGCATGTGAGG No data
Right 1045300628 8:100907571-100907593 ATCGCAAGCGCTTCTACTGCAGG No data
1045300623_1045300627 -7 Left 1045300623 8:100907524-100907546 CCAGGCACCTGCTGCATGTGAGG No data
Right 1045300627 8:100907540-100907562 TGTGAGGCTGCAGCTGGATCAGG No data
1045300623_1045300629 30 Left 1045300623 8:100907524-100907546 CCAGGCACCTGCTGCATGTGAGG No data
Right 1045300629 8:100907577-100907599 AGCGCTTCTACTGCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045300623 Original CRISPR CCTCACATGCAGCAGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr