ID: 1045301172

View in Genome Browser
Species Human (GRCh38)
Location 8:100911519-100911541
Sequence TATTGGGTATAGCACTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045301167_1045301172 -2 Left 1045301167 8:100911498-100911520 CCGAAGCTTAAATTGTGCCTCTA No data
Right 1045301172 8:100911519-100911541 TATTGGGTATAGCACTTGGCTGG No data
1045301166_1045301172 2 Left 1045301166 8:100911494-100911516 CCTTCCGAAGCTTAAATTGTGCC No data
Right 1045301172 8:100911519-100911541 TATTGGGTATAGCACTTGGCTGG No data
1045301165_1045301172 3 Left 1045301165 8:100911493-100911515 CCCTTCCGAAGCTTAAATTGTGC No data
Right 1045301172 8:100911519-100911541 TATTGGGTATAGCACTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045301172 Original CRISPR TATTGGGTATAGCACTTGGC TGG Intergenic
No off target data available for this crispr