ID: 1045305352

View in Genome Browser
Species Human (GRCh38)
Location 8:100952527-100952549
Sequence GCTCCCGTTCAGCAACATCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045305349_1045305352 -10 Left 1045305349 8:100952514-100952536 CCCTCTGGAAGGGGCTCCCGTTC 0: 1
1: 0
2: 2
3: 12
4: 118
Right 1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG 0: 1
1: 0
2: 1
3: 4
4: 67
1045305347_1045305352 -1 Left 1045305347 8:100952505-100952527 CCAGTCACTCCCTCTGGAAGGGG 0: 1
1: 0
2: 2
3: 18
4: 252
Right 1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG 0: 1
1: 0
2: 1
3: 4
4: 67
1045305343_1045305352 1 Left 1045305343 8:100952503-100952525 CCCCAGTCACTCCCTCTGGAAGG 0: 1
1: 0
2: 2
3: 42
4: 358
Right 1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG 0: 1
1: 0
2: 1
3: 4
4: 67
1045305341_1045305352 14 Left 1045305341 8:100952490-100952512 CCGTCTGCGCTTGCCCCAGTCAC 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG 0: 1
1: 0
2: 1
3: 4
4: 67
1045305340_1045305352 15 Left 1045305340 8:100952489-100952511 CCCGTCTGCGCTTGCCCCAGTCA 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG 0: 1
1: 0
2: 1
3: 4
4: 67
1045305345_1045305352 0 Left 1045305345 8:100952504-100952526 CCCAGTCACTCCCTCTGGAAGGG 0: 1
1: 0
2: 0
3: 21
4: 184
Right 1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG 0: 1
1: 0
2: 1
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045305352 Original CRISPR GCTCCCGTTCAGCAACATCC GGG Intronic
901060925 1:6471604-6471626 GCGCCTGTTCAGCAACATCCCGG - Exonic
902378920 1:16043584-16043606 GCCCCCGTCCAGCAGCACCCAGG + Intergenic
910711889 1:90190281-90190303 GCTCCTGTGTAGAAACATCCAGG - Intergenic
916760104 1:167808036-167808058 GCTCCAGTTCAGCCACTTACTGG + Intergenic
916842481 1:168614341-168614363 CCTGCATTTCAGCAACATCCTGG - Intergenic
923043070 1:230333578-230333600 GCTCGCGTTCAGCCACGTCCTGG - Intronic
1064594912 10:16934001-16934023 ATTCCAGTTCAGCAACTTCCTGG - Intronic
1066395548 10:35017764-35017786 ACTACAGTTCTGCAACATCCTGG + Intronic
1070539627 10:77406811-77406833 GGACCAGTTCAGAAACATCCTGG - Intronic
1071406115 10:85334148-85334170 GATCCATTTCAGCAACATCTGGG + Intergenic
1071888715 10:89979003-89979025 GTCCCCGTGCAGGAACATCCTGG - Intergenic
1074338469 10:112602350-112602372 GCTCATTTTCAGCAATATCCCGG - Intronic
1076947602 10:133662082-133662104 GCTCCTGGACAGCAACATGCTGG - Intergenic
1079028497 11:16967677-16967699 GCTCCCCTTCTGCAACACTCAGG + Intronic
1082101146 11:48174122-48174144 GCCCCCTTTCAGCCACACCCTGG + Intergenic
1086448875 11:86896500-86896522 GCTCTCTTTCAGCATCAGCCAGG + Intronic
1088788295 11:113202016-113202038 GCTCCAAAACAGCAACATCCTGG - Intronic
1090304390 11:125678228-125678250 ACTTCAGTTCAGCAACTTCCAGG - Exonic
1096551732 12:52377751-52377773 TCTCCCTGTCAGCAACAGCCTGG - Intergenic
1099417545 12:82410555-82410577 GCTACAGTTCAGCTAGATCCTGG + Intronic
1112602596 13:100871161-100871183 GATACAGTTCAACAACATCCTGG - Intergenic
1113419918 13:110163223-110163245 GCTGCCTTTCAACAACATCTGGG + Intronic
1113484592 13:110645074-110645096 GCTCCCGTGCAGGAGCAGCCTGG + Intronic
1114062950 14:19037322-19037344 ACTCCCGTTCTGCCACGTCCTGG - Intergenic
1114099310 14:19362675-19362697 ACTCCCGTTCTGCCACGTCCTGG + Intergenic
1119784315 14:77301029-77301051 GCTCCTACTCAGCAACATCAGGG + Intronic
1122002268 14:98668797-98668819 TTTCTCCTTCAGCAACATCCTGG + Intergenic
1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG + Intergenic
1133297530 16:4762237-4762259 GCTCCTGGTCTGCAGCATCCTGG - Intronic
1141686143 16:85571090-85571112 CCTCCCCTTTAGCAAGATCCGGG - Intergenic
1142848992 17:2695340-2695362 GCTCCCGTTCCGCCCCACCCCGG + Intronic
1145241683 17:21243934-21243956 GCTCCTGTTCTGCAAGACCCTGG - Intronic
1147833788 17:43315583-43315605 GCTCCCGGTCTGGACCATCCGGG - Intergenic
1157150556 18:45213078-45213100 GTTCCTGTTCAGAAACACCCAGG - Intronic
1162904984 19:13817996-13818018 CCTACCCTTCAGCAACAGCCAGG - Intronic
1165119848 19:33552029-33552051 GCTCCCAGCCAGCAGCATCCAGG - Intergenic
925134913 2:1520114-1520136 GCTCCAGGGCAGAAACATCCTGG + Intronic
925681418 2:6425641-6425663 GCTCCCTTTCAGCCACACCTGGG + Intergenic
931971122 2:67587844-67587866 ACTCCTTTTCAGCAACATACTGG - Intergenic
934524832 2:95045363-95045385 GCTCTAGTTCAGCCACACCCAGG + Intronic
934954603 2:98607256-98607278 GCTGCCGTTCAGCCAGCTCCTGG - Intronic
938480312 2:131657482-131657504 ACTCCCGTTCTGCCACGTCCTGG - Intergenic
940458379 2:153931371-153931393 ACTCCTATTCAGCAACATACTGG - Intronic
1171034982 20:21707018-21707040 ACACTCGGTCAGCAACATCCTGG + Exonic
1177336790 21:19738665-19738687 GCTGCCCTTAAGCAACATCTGGG + Intergenic
1179021326 21:37643543-37643565 ACTCCCGTGCAGCAACTCCCTGG - Intronic
1180481443 22:15759949-15759971 ACTCCCGTTCTGCCACGTCCTGG - Intergenic
1183333455 22:37233688-37233710 ACTCCCCTTCTGCAGCATCCTGG - Intronic
1183488331 22:38102360-38102382 GCTCCCTTTCTGCAATTTCCTGG - Intronic
1184834947 22:47015649-47015671 GCTCCCGGACAGCAGCAGCCAGG + Intronic
951033861 3:17911476-17911498 ACTCCTGTTCAGTAAAATCCAGG - Intronic
960034393 3:113087890-113087912 GTTCCCCTTCAGCTACATCAGGG + Intergenic
970026163 4:11626230-11626252 GCTTCCGTTAACCAGCATCCAGG - Intergenic
999247849 5:150164875-150164897 CCGCCCGGTCAGCAACAGCCAGG + Intergenic
999328674 5:150658656-150658678 CCTCACCTTTAGCAACATCCTGG - Intronic
1014113221 6:117644684-117644706 TCTCCCGTTCAGCAATATTCTGG - Intergenic
1018036435 6:159886639-159886661 CCTCCAGTTCAGCACCATCTGGG - Intergenic
1018430146 6:163715778-163715800 GCTCCGCTTCAGCACCTTCCAGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019527440 7:1487119-1487141 GCGCCCGCTCAGCACCTTCCAGG + Intronic
1025723416 7:64036805-64036827 GCTCCAGTTCAGCAGCATTTGGG - Intronic
1026592604 7:71710158-71710180 TCTTCTGTTCAGCAACATCGGGG - Intronic
1031026603 7:116686238-116686260 GCTCCCGGTCAACAAAGTCCAGG + Intronic
1032490502 7:132320755-132320777 GCTCCTGACCAGCAGCATCCGGG + Intronic
1033479094 7:141721343-141721365 CCTCCCCTTAAGCAACATCCAGG + Intronic
1039733490 8:40305300-40305322 GCTCCTGTTCAGCAGCACCCAGG + Intergenic
1041125893 8:54638034-54638056 GCTATCCCTCAGCAACATCCTGG + Intergenic
1042105261 8:65319550-65319572 GCCCCCTTTCAGCATCTTCCAGG + Intergenic
1044972407 8:97632743-97632765 TCTCCCCTCCAGCAACATTCAGG - Intergenic
1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG + Intronic
1061537299 9:131258042-131258064 TCTCCACTTCAGAAACATCCAGG + Intergenic
1062196799 9:135278774-135278796 GCACGCGATCAGCAACATCAAGG + Intergenic
1191192311 X:57679667-57679689 GATCCCGTTCAGCAACCCCAGGG - Intergenic