ID: 1045305866

View in Genome Browser
Species Human (GRCh38)
Location 8:100956180-100956202
Sequence CTGTGGGAGGGTGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045305856_1045305866 11 Left 1045305856 8:100956146-100956168 CCAAGTGCAGTGGCTCACGCTTG 0: 15
1: 663
2: 10274
3: 45268
4: 102953
Right 1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045305866 Original CRISPR CTGTGGGAGGGTGAGGTGGA TGG Intergenic
No off target data available for this crispr