ID: 1045306892

View in Genome Browser
Species Human (GRCh38)
Location 8:100965415-100965437
Sequence TAATTCCCACATGTAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045306892_1045306898 2 Left 1045306892 8:100965415-100965437 CCTCCCTCTACATGTGGGAATTA No data
Right 1045306898 8:100965440-100965462 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
1045306892_1045306896 -2 Left 1045306892 8:100965415-100965437 CCTCCCTCTACATGTGGGAATTA No data
Right 1045306896 8:100965436-100965458 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
1045306892_1045306895 -3 Left 1045306892 8:100965415-100965437 CCTCCCTCTACATGTGGGAATTA No data
Right 1045306895 8:100965435-100965457 TTACAATTCAAGATGAGATTTGG 0: 2206
1: 9725
2: 12425
3: 11533
4: 7780
1045306892_1045306897 1 Left 1045306892 8:100965415-100965437 CCTCCCTCTACATGTGGGAATTA No data
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045306892 Original CRISPR TAATTCCCACATGTAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr