ID: 1045306897

View in Genome Browser
Species Human (GRCh38)
Location 8:100965439-100965461
Sequence AATTCAAGATGAGATTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43710
Summary {0: 7468, 1: 11239, 2: 9760, 3: 8452, 4: 6791}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045306886_1045306897 20 Left 1045306886 8:100965396-100965418 CCGATGATCCAATCACCTCCCTC 0: 150
1: 2253
2: 4934
3: 10035
4: 12544
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306890_1045306897 5 Left 1045306890 8:100965411-100965433 CCTCCCTCCCTCTACATGTGGGA No data
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306884_1045306897 22 Left 1045306884 8:100965394-100965416 CCCCGATGATCCAATCACCTCCC 0: 6
1: 1967
2: 4627
3: 9465
4: 12293
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306892_1045306897 1 Left 1045306892 8:100965415-100965437 CCTCCCTCTACATGTGGGAATTA No data
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306894_1045306897 -3 Left 1045306894 8:100965419-100965441 CCTCTACATGTGGGAATTACAAT No data
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306885_1045306897 21 Left 1045306885 8:100965395-100965417 CCCGATGATCCAATCACCTCCCT No data
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306893_1045306897 -2 Left 1045306893 8:100965418-100965440 CCCTCTACATGTGGGAATTACAA No data
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306887_1045306897 12 Left 1045306887 8:100965404-100965426 CCAATCACCTCCCTCCCTCTACA 0: 7
1: 92
2: 260
3: 453
4: 1533
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1045306891_1045306897 2 Left 1045306891 8:100965414-100965436 CCCTCCCTCTACATGTGGGAATT No data
Right 1045306897 8:100965439-100965461 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045306897 Original CRISPR AATTCAAGATGAGATTTGGG TGG Intergenic
Too many off-targets to display for this crispr