ID: 1045309826

View in Genome Browser
Species Human (GRCh38)
Location 8:100991469-100991491
Sequence TTCATGCTTCCTCATAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045309826_1045309830 11 Left 1045309826 8:100991469-100991491 CCACACTTATGAGGAAGCATGAA No data
Right 1045309830 8:100991503-100991525 TTTAGAAAGGTAAAGACATGTGG No data
1045309826_1045309828 -2 Left 1045309826 8:100991469-100991491 CCACACTTATGAGGAAGCATGAA No data
Right 1045309828 8:100991490-100991512 AAACAGTTTGGCCTTTAGAAAGG No data
1045309826_1045309831 15 Left 1045309826 8:100991469-100991491 CCACACTTATGAGGAAGCATGAA No data
Right 1045309831 8:100991507-100991529 GAAAGGTAAAGACATGTGGCCGG No data
1045309826_1045309833 21 Left 1045309826 8:100991469-100991491 CCACACTTATGAGGAAGCATGAA No data
Right 1045309833 8:100991513-100991535 TAAAGACATGTGGCCGGGCGCGG No data
1045309826_1045309832 16 Left 1045309826 8:100991469-100991491 CCACACTTATGAGGAAGCATGAA No data
Right 1045309832 8:100991508-100991530 AAAGGTAAAGACATGTGGCCGGG No data
1045309826_1045309834 24 Left 1045309826 8:100991469-100991491 CCACACTTATGAGGAAGCATGAA No data
Right 1045309834 8:100991516-100991538 AGACATGTGGCCGGGCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045309826 Original CRISPR TTCATGCTTCCTCATAAGTG TGG (reversed) Intergenic
No off target data available for this crispr