ID: 1045312731

View in Genome Browser
Species Human (GRCh38)
Location 8:101017293-101017315
Sequence GCAGGGAAGAAACGGGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045312722_1045312731 12 Left 1045312722 8:101017258-101017280 CCGCTGAGCATCCAAGGATTAAC No data
Right 1045312731 8:101017293-101017315 GCAGGGAAGAAACGGGTCTCTGG No data
1045312726_1045312731 1 Left 1045312726 8:101017269-101017291 CCAAGGATTAACAGGGGACTGAA No data
Right 1045312731 8:101017293-101017315 GCAGGGAAGAAACGGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045312731 Original CRISPR GCAGGGAAGAAACGGGTCTC TGG Intergenic
No off target data available for this crispr