ID: 1045320075

View in Genome Browser
Species Human (GRCh38)
Location 8:101075656-101075678
Sequence GAGGGAAACCTAACTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045320075_1045320082 2 Left 1045320075 8:101075656-101075678 CCACCCACAGTTAGGTTTCCCTC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1045320082 8:101075681-101075703 AAGTGCTTTATCTCCACGTGGGG 0: 1
1: 0
2: 2
3: 18
4: 139
1045320075_1045320081 1 Left 1045320075 8:101075656-101075678 CCACCCACAGTTAGGTTTCCCTC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1045320081 8:101075680-101075702 CAAGTGCTTTATCTCCACGTGGG 0: 1
1: 0
2: 1
3: 5
4: 94
1045320075_1045320080 0 Left 1045320075 8:101075656-101075678 CCACCCACAGTTAGGTTTCCCTC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1045320080 8:101075679-101075701 TCAAGTGCTTTATCTCCACGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045320075 Original CRISPR GAGGGAAACCTAACTGTGGG TGG (reversed) Intergenic
901456253 1:9364517-9364539 GAGGGAAACCCAACCCTGTGAGG + Intronic
912086180 1:106007912-106007934 GAGTGAACCCTAACTCTGGGTGG + Intergenic
913987888 1:143582657-143582679 GAGGGACACCCACCTGTGTGGGG + Intergenic
914815727 1:151060551-151060573 CAGGTAAACCAAACTGAGGGAGG + Exonic
915025317 1:152824104-152824126 GAGGGAAAAGTTACTGTGGATGG - Intergenic
918400308 1:184156359-184156381 TAGGCAAAACTAACTTTGGGAGG - Intergenic
919331812 1:196181701-196181723 GAGAGACCCCTATCTGTGGGTGG + Intergenic
919827946 1:201517277-201517299 GAGGCTAAACTAACTTTGGGAGG + Intergenic
921412416 1:214849985-214850007 TATAGAAACCTAACTGTGGTAGG + Intergenic
923113326 1:230910491-230910513 GAGAGAAACAGAAGTGTGGGAGG + Intronic
1065885760 10:30075546-30075568 GATTGAAATCTAACAGTGGGAGG - Intronic
1067945624 10:50686478-50686500 AAGGGAATCATAGCTGTGGGGGG - Intergenic
1070636721 10:78134489-78134511 GAGGGAAACCTATCTTTCTGTGG + Intergenic
1070867137 10:79713351-79713373 AAGGGAATCATAGCTGTGGGGGG - Intronic
1070880927 10:79851472-79851494 AAGGGAATCATAGCTGTGGGGGG - Intergenic
1071634052 10:87235575-87235597 AAGGGAATCATAGCTGTGGGGGG - Intronic
1071647498 10:87367792-87367814 AAGGGAATCATAGCTGTGGGGGG - Intronic
1071828342 10:89347963-89347985 GATGGAAACCTTACGGTGGTAGG - Intronic
1072517583 10:96201025-96201047 GGGGGAAACCCAACTGTGGATGG - Exonic
1073072775 10:100805428-100805450 GGGGGAAACCCCACTTTGGGGGG + Intronic
1074529120 10:114284953-114284975 GAGGGGAGGCTAACTGTGGTAGG + Exonic
1075297944 10:121294514-121294536 GAGGCAATGCTAACTGTTGGTGG - Intergenic
1077101960 11:826333-826355 GAGTGAAACCCTCCTGTGGGGGG - Intronic
1077331256 11:1984701-1984723 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1078527747 11:12112928-12112950 GAGGCAAACCCAGGTGTGGGTGG - Intronic
1081669556 11:44935451-44935473 GATGAAAACCTGTCTGTGGGGGG - Intronic
1081724634 11:45319637-45319659 TAGGCCAACCTAACTTTGGGAGG - Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085518730 11:77126058-77126080 GAGGGAAGCCTAGGTCTGGGTGG - Exonic
1086174517 11:83873852-83873874 GAGGGATACCTAACTGTAAATGG - Intronic
1087599875 11:100300282-100300304 GAGGAAAAGCTAACTTTAGGGGG - Intronic
1088900649 11:114114310-114114332 GAGGGAAACCTGACTGGGGAGGG + Intronic
1090406507 11:126478952-126478974 GAGGGAAGCCTGGCTGAGGGGGG + Intronic
1091058707 11:132442280-132442302 GAGAGAAACCTAACTATTTGGGG + Intronic
1202814237 11_KI270721v1_random:39877-39899 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1091651151 12:2311048-2311070 GAGGAAAGCCTCACTGTGTGTGG - Intronic
1091652829 12:2322616-2322638 GAGGAACACCTGACTTTGGGAGG - Intronic
1094741131 12:33290530-33290552 TAGGCCAACCTAACTTTGGGAGG + Intergenic
1096502426 12:52072860-52072882 GAGGATAACTTAAATGTGGGAGG - Intronic
1096555045 12:52398653-52398675 GAGTGAAACCTGGCCGTGGGTGG + Intronic
1096710795 12:53453613-53453635 GGAGGAAATCTAGCTGTGGGAGG + Intronic
1100764608 12:97849843-97849865 GAGGGCAACATAACTTTTGGTGG - Intergenic
1101400482 12:104382610-104382632 GAGGGCACCATAGCTGTGGGTGG - Intergenic
1102590073 12:113950315-113950337 GAGGGAAATTTGGCTGTGGGTGG - Intronic
1103632058 12:122269464-122269486 GATGGAAACCGGACAGTGGGTGG - Intergenic
1105072790 12:133245694-133245716 GAGGGGTACCTCACTGTGTGAGG - Intergenic
1106469411 13:30040973-30040995 CAGGGAAAACTAAGTGAGGGAGG - Intergenic
1108200969 13:48042609-48042631 CAGGCCAACCTAACTATGGGAGG - Intronic
1108216760 13:48192960-48192982 CAGGCAAACCTAACTGGAGGTGG - Intergenic
1108694348 13:52889570-52889592 CAGGTAAACCTAATTGTGAGAGG + Intergenic
1112951370 13:105001155-105001177 GAGACACACCTGACTGTGGGAGG - Intergenic
1114282313 14:21204308-21204330 GGGGGAAAGCTAAGTTTGGGGGG + Intergenic
1115307322 14:31946040-31946062 GAGAGAAGCCTTCCTGTGGGAGG - Intronic
1117499763 14:56339955-56339977 GAGGGAGACATAGCTTTGGGTGG - Intergenic
1119139863 14:72256691-72256713 TAGGCCAACCTAACTATGGGAGG - Intronic
1120536946 14:85708084-85708106 GAGGGGAACATAAATGTGTGAGG + Intergenic
1121325574 14:93017739-93017761 GAGGGAAACCCACTTGGGGGTGG - Intronic
1124178175 15:27446956-27446978 GTGGGAAAGCTAACTCTGTGTGG - Intronic
1124561315 15:30775908-30775930 GAGGGGTACCTAGCTGTGTGAGG - Intergenic
1127506168 15:59599937-59599959 GAGGCCAAACTAACTGTAGGAGG - Intronic
1128681889 15:69658478-69658500 GAAGAAAACCTAACTGTGAAGGG - Intergenic
1130417425 15:83706733-83706755 GAGGATCACCTAAGTGTGGGTGG - Intronic
1132216769 15:100068521-100068543 GAGGGATACCCAGCTGTGTGAGG - Intronic
1133233583 16:4377621-4377643 GAGGGAAGGCTGACTGTGGAGGG - Intronic
1139884510 16:70198770-70198792 CAGTGAAGCCCAACTGTGGGAGG - Intergenic
1140368011 16:74396722-74396744 CAGTGAAGCCCAACTGTGGGAGG + Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1141913661 16:87077904-87077926 GAGGGACACCCTGCTGTGGGGGG + Intergenic
1143736438 17:8914865-8914887 GAGGGAAACCTATCAGAAGGAGG + Intronic
1143993661 17:10988613-10988635 GAGGGAAACCCAACAATGGTTGG - Intergenic
1146720277 17:35119217-35119239 GAGGAAAAACCAAGTGTGGGAGG - Intronic
1148950964 17:51312062-51312084 TAGGCAAAACTAACTTTGGGAGG - Intergenic
1152645196 17:81465515-81465537 CAGGGGAACCTTAGTGTGGGAGG - Exonic
1152920344 17:83063418-83063440 GAGGGAGACCTCCCTGTGTGGGG - Intergenic
1157853154 18:51077193-51077215 GAGAGAAAACTAAGTGAGGGTGG + Intronic
1158574105 18:58621692-58621714 GAAGGAGGCCTAAGTGTGGGGGG + Intronic
1158695538 18:59700104-59700126 GAGGAAATCCCAACGGTGGGTGG + Intergenic
1165133309 19:33646966-33646988 TAGGCCAAGCTAACTGTGGGAGG - Intronic
1166264180 19:41667170-41667192 TAGGACAGCCTAACTGTGGGAGG - Intronic
1167217441 19:48173955-48173977 GCTGGAAACCTAACTGTGTGGGG - Intronic
1167428636 19:49442253-49442275 GTGTGAAATATAACTGTGGGGGG - Intronic
1168126805 19:54288495-54288517 GTGGGAAACATGACTGTGGGGGG + Intergenic
1168165392 19:54543593-54543615 GAGGGAATCCTGTCTGTGAGAGG - Exonic
928205328 2:29279610-29279632 TAGGGAAACCTGAATCTGGGTGG - Intronic
932416654 2:71577699-71577721 GACGGAAACGTGACTGTGGAGGG - Intronic
933933292 2:87177803-87177825 TAGGGAAACTTAAGTGTTGGTGG - Intergenic
934871543 2:97871314-97871336 CAGGCAAAGCTAACTTTGGGAGG + Intronic
936359822 2:111787643-111787665 TAGGGAAACTTAAGTGTTGGTGG + Intronic
948349247 2:237324764-237324786 GATGGGAACCTAAGCGTGGGTGG - Exonic
948806796 2:240456555-240456577 GAGGGAAACGTGCCTGGGGGAGG - Intronic
1169408249 20:5344217-5344239 ATGGGAAACCTGACTGTGGTGGG + Intergenic
1169570722 20:6902301-6902323 GAGGGAGAGCAAACTGTGGTGGG + Intergenic
1170344697 20:15371577-15371599 AAGGGAATCCTAACTATGGATGG + Intronic
1172305257 20:33876090-33876112 GAGGGGATCCTGACAGTGGGAGG + Intergenic
1173647764 20:44644179-44644201 GAGGCAAACCCAACTGCCGGAGG - Intronic
1175070686 20:56331325-56331347 TAGGCCAACCTAACTTTGGGAGG + Intergenic
1175459220 20:59138592-59138614 TAGGGAGACCTAACTTTGAGGGG - Intergenic
1177550068 21:22609228-22609250 GAGGTCAAACTAACTTTGGGAGG + Intergenic
1183674072 22:39290131-39290153 GAGGGAAGCCCAACTGCGGCTGG - Intergenic
950494993 3:13328438-13328460 CAGGGAAACACAACTGTGGCAGG + Intronic
950965706 3:17144330-17144352 GATGGAAATGTCACTGTGGGTGG + Intergenic
953749725 3:45600048-45600070 GAGGAAAAAGTATCTGTGGGAGG - Intronic
953914281 3:46908707-46908729 GAGGCAAACCTGAGTGTGTGCGG + Intergenic
957284568 3:78201805-78201827 GAGAGAAAGCTAACTATGTGAGG + Intergenic
959189182 3:103088119-103088141 GAGGGAAAGCCAAGTGTGGCTGG + Intergenic
960820783 3:121728875-121728897 GAGGGAAACATACCTTTTGGAGG - Intronic
961412708 3:126734288-126734310 GAGGGAAGCATGGCTGTGGGCGG + Intronic
961498989 3:127317071-127317093 GTGGGAAAGCTGACTGTTGGTGG + Intergenic
962191625 3:133316923-133316945 CAGGGAAGTCAAACTGTGGGTGG + Intronic
965077575 3:163998845-163998867 GAAGGAAACCTAACTCTTGCAGG - Intergenic
967033498 3:185630335-185630357 GAGGGAACTCTCACTGGGGGCGG + Exonic
967148765 3:186628923-186628945 CAGGCCAACCTAACTATGGGAGG - Intergenic
970506166 4:16732770-16732792 GAGGGAAAGAAAATTGTGGGAGG + Intronic
977657547 4:99539288-99539310 GGGGGCAATTTAACTGTGGGTGG - Exonic
982064127 4:151637572-151637594 GAAGGAAACCTAACTGAGCTGGG + Intronic
982677339 4:158390845-158390867 TATGGAAGCCTAACTGAGGGTGG + Intronic
983736388 4:171067789-171067811 TAGGCCAAGCTAACTGTGGGAGG + Intergenic
985997612 5:3605568-3605590 AAGGGACACCTAAAGGTGGGTGG - Intergenic
986990167 5:13543314-13543336 CAGGCCAAGCTAACTGTGGGAGG + Intergenic
987216088 5:15738865-15738887 GAGGAAAACCAAAGTGTGAGTGG + Intronic
988214289 5:28251127-28251149 GAGGGAAACCAAACAACGGGTGG - Intergenic
988875269 5:35438426-35438448 GAGGGAAATGTGACTATGGGAGG - Intergenic
990910255 5:60844645-60844667 GAGGAAAACCTAGCTGAGGCTGG + Intergenic
992486628 5:77203313-77203335 GAGAGAAAGATCACTGTGGGTGG - Intergenic
993619154 5:90147515-90147537 GAGGGTTACCCAGCTGTGGGAGG - Intergenic
996281817 5:121739288-121739310 GAGGGCAACCTGCATGTGGGAGG - Intergenic
999962142 5:156767287-156767309 GGGAGAAACCTGACTGGGGGAGG - Intronic
1000490957 5:161912851-161912873 GAGGGAGGCTTAACTGAGGGAGG + Intergenic
1000587836 5:163122203-163122225 GAGGGATACCTGGCTGTGTGAGG + Intergenic
1003852428 6:10238954-10238976 GATGGGAACCAAACTGTAGGTGG - Intergenic
1003986234 6:11437878-11437900 ATGGGAAACCTAACTGGGGAAGG + Intergenic
1005115163 6:22328032-22328054 GAAGAAAAGCTAACTGTGTGAGG + Intergenic
1005893139 6:30156287-30156309 TAGGGTGACATAACTGTGGGTGG + Intronic
1006091875 6:31633052-31633074 GAGGGAAAGATAAGTTTGGGTGG + Intronic
1008863510 6:56181042-56181064 GATGGCAACCTAACTGTGGAAGG - Intronic
1009989014 6:70818135-70818157 AATGAAAACCTAACTTTGGGAGG + Intronic
1016163984 6:140917095-140917117 TAGGCCAAACTAACTGTGGGAGG + Intergenic
1019782441 7:2951436-2951458 GAGGCCAAACTAACTTTGGGAGG + Intronic
1020585810 7:10065136-10065158 GTGAGAAAACTAACTGAGGGTGG + Intergenic
1021261265 7:18460175-18460197 GAAGCAAACATAACTTTGGGAGG - Intronic
1024202646 7:47122364-47122386 CAGGGTAACTTTACTGTGGGAGG - Intergenic
1026114480 7:67484670-67484692 CAGGGCAACCTAGCTGTGGCTGG + Intergenic
1031483048 7:122300813-122300835 GATGAAAACCAAACTGTGGCGGG - Intergenic
1032778682 7:135143926-135143948 AAGGGAAACTCCACTGTGGGAGG + Intronic
1032941810 7:136802092-136802114 GAGGGAAACCAAAGTCTGTGTGG - Intergenic
1033145812 7:138869312-138869334 GAGGGTCACCTTAGTGTGGGAGG - Intronic
1033427204 7:141255004-141255026 GAGAGAAACTTAACTGTGCTAGG + Intronic
1036619451 8:10415061-10415083 GAGGGAAACCATCCTGCGGGTGG + Intronic
1037905076 8:22711478-22711500 AAGGGAAACCAAACTGAAGGGGG + Intergenic
1040855405 8:51943703-51943725 GAGGCCAAGCTAACTTTGGGAGG + Intergenic
1042939607 8:74094145-74094167 CTGGGAAACCTAATTGTGGGTGG + Intergenic
1045320075 8:101075656-101075678 GAGGGAAACCTAACTGTGGGTGG - Intergenic
1045705665 8:104919831-104919853 TAGGGAAAACTACCTGGGGGAGG - Intronic
1047070426 8:121336880-121336902 GAGGGAGAACTATCTGTGGATGG + Intergenic
1052039035 9:23717097-23717119 AAGGGAAACTTAACTGTAGATGG - Intronic
1052803203 9:32989214-32989236 TTGGGAAACCTTGCTGTGGGGGG + Intronic
1054951956 9:70862145-70862167 GAGAGAAAACTAGCTGAGGGTGG - Intronic
1055126843 9:72728655-72728677 GAAGGAAACCAAAATTTGGGAGG - Intronic
1055468137 9:76585570-76585592 TAGGCCAAGCTAACTGTGGGAGG - Intergenic
1058804417 9:108577252-108577274 GAAGGGAACCTACCTGTGGGTGG + Intergenic
1060834772 9:126746960-126746982 GAGGGAAACCAAGATGTGGGAGG - Intergenic
1185461248 X:333657-333679 GGGGGACACCTAAATGAGGGGGG - Intergenic
1186317064 X:8382391-8382413 TAGGGAAATCTAACTTTAGGAGG - Intergenic
1187532029 X:20105803-20105825 CATGGAACCATAACTGTGGGAGG - Intronic
1188219736 X:27526897-27526919 GAGGGATACCCAGCTGTGTGAGG + Intergenic
1191631023 X:63322345-63322367 GAGGCATACACAACTGTGGGTGG - Intergenic
1194475995 X:94360639-94360661 TAGGGTAAACTAACTTTGGGAGG + Intergenic
1195632047 X:107067410-107067432 GAGGAAAAACTAACTGAGGGAGG - Exonic
1196466931 X:115982429-115982451 GAGGAGAAGCTAACTTTGGGAGG + Intergenic
1196805523 X:119581554-119581576 GAGACAAATCTAACTGTAGGTGG - Exonic
1199330064 X:146549013-146549035 AAGGGGAACCTAACTGAGGGTGG - Intergenic
1199440531 X:147863101-147863123 GAGGAAAAAATAACTGGGGGGGG + Intergenic