ID: 1045321135

View in Genome Browser
Species Human (GRCh38)
Location 8:101081985-101082007
Sequence CCTCTCCTGCAGAAGTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045321135_1045321141 30 Left 1045321135 8:101081985-101082007 CCTACCCACTTCTGCAGGAGAGG No data
Right 1045321141 8:101082038-101082060 GACTTCGTGCTAATAATACCAGG No data
1045321135_1045321139 1 Left 1045321135 8:101081985-101082007 CCTACCCACTTCTGCAGGAGAGG No data
Right 1045321139 8:101082009-101082031 AGTTTATTTTCTAGAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045321135 Original CRISPR CCTCTCCTGCAGAAGTGGGT AGG (reversed) Intergenic
No off target data available for this crispr