ID: 1045322199

View in Genome Browser
Species Human (GRCh38)
Location 8:101090801-101090823
Sequence CAGTGGGGATGGAGAGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045322188_1045322199 15 Left 1045322188 8:101090763-101090785 CCAGGCTGGAGACAGTGGTGGCT No data
Right 1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045322199 Original CRISPR CAGTGGGGATGGAGAGAATT GGG Intergenic
No off target data available for this crispr