ID: 1045332400

View in Genome Browser
Species Human (GRCh38)
Location 8:101166597-101166619
Sequence CAAGCAGATCCCTTGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045332400_1045332408 17 Left 1045332400 8:101166597-101166619 CCCCCCACCAAGGGATCTGCTTG No data
Right 1045332408 8:101166637-101166659 TGACTCTGATTCTTTAGACAAGG No data
1045332400_1045332409 27 Left 1045332400 8:101166597-101166619 CCCCCCACCAAGGGATCTGCTTG No data
Right 1045332409 8:101166647-101166669 TCTTTAGACAAGGCCCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045332400 Original CRISPR CAAGCAGATCCCTTGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr