ID: 1045336050

View in Genome Browser
Species Human (GRCh38)
Location 8:101205377-101205399
Sequence ACGCCCGGGAAACGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045336050_1045336069 21 Left 1045336050 8:101205377-101205399 CCCCCGCCCCGTTTCCCGGGCGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336050_1045336063 16 Left 1045336050 8:101205377-101205399 CCCCCGCCCCGTTTCCCGGGCGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1045336063 8:101205416-101205438 CGCCCCCGCTGCCGCTCACCCGG 0: 1
1: 1
2: 2
3: 25
4: 242
1045336050_1045336070 22 Left 1045336050 8:101205377-101205399 CCCCCGCCCCGTTTCCCGGGCGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1045336070 8:101205422-101205444 CGCTGCCGCTCACCCGGGCCGGG 0: 1
1: 0
2: 1
3: 31
4: 187
1045336050_1045336064 17 Left 1045336050 8:101205377-101205399 CCCCCGCCCCGTTTCCCGGGCGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1045336064 8:101205417-101205439 GCCCCCGCTGCCGCTCACCCGGG 0: 1
1: 0
2: 3
3: 42
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045336050 Original CRISPR ACGCCCGGGAAACGGGGCGG GGG (reversed) Intronic