ID: 1045336052

View in Genome Browser
Species Human (GRCh38)
Location 8:101205379-101205401
Sequence GGACGCCCGGGAAACGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045336052_1045336063 14 Left 1045336052 8:101205379-101205401 CCCGCCCCGTTTCCCGGGCGTCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1045336063 8:101205416-101205438 CGCCCCCGCTGCCGCTCACCCGG 0: 1
1: 1
2: 2
3: 25
4: 242
1045336052_1045336064 15 Left 1045336052 8:101205379-101205401 CCCGCCCCGTTTCCCGGGCGTCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1045336064 8:101205417-101205439 GCCCCCGCTGCCGCTCACCCGGG 0: 1
1: 0
2: 3
3: 42
4: 316
1045336052_1045336070 20 Left 1045336052 8:101205379-101205401 CCCGCCCCGTTTCCCGGGCGTCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1045336070 8:101205422-101205444 CGCTGCCGCTCACCCGGGCCGGG 0: 1
1: 0
2: 1
3: 31
4: 187
1045336052_1045336069 19 Left 1045336052 8:101205379-101205401 CCCGCCCCGTTTCCCGGGCGTCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045336052 Original CRISPR GGACGCCCGGGAAACGGGGC GGG (reversed) Intronic