ID: 1045336058

View in Genome Browser
Species Human (GRCh38)
Location 8:101205391-101205413
Sequence GCTGACGCCGCGGGACGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045336058_1045336063 2 Left 1045336058 8:101205391-101205413 CCCGGGCGTCCCGCGGCGTCAGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1045336063 8:101205416-101205438 CGCCCCCGCTGCCGCTCACCCGG 0: 1
1: 1
2: 2
3: 25
4: 242
1045336058_1045336069 7 Left 1045336058 8:101205391-101205413 CCCGGGCGTCCCGCGGCGTCAGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336058_1045336064 3 Left 1045336058 8:101205391-101205413 CCCGGGCGTCCCGCGGCGTCAGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1045336064 8:101205417-101205439 GCCCCCGCTGCCGCTCACCCGGG 0: 1
1: 0
2: 3
3: 42
4: 316
1045336058_1045336074 23 Left 1045336058 8:101205391-101205413 CCCGGGCGTCCCGCGGCGTCAGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336058_1045336070 8 Left 1045336058 8:101205391-101205413 CCCGGGCGTCCCGCGGCGTCAGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1045336070 8:101205422-101205444 CGCTGCCGCTCACCCGGGCCGGG 0: 1
1: 0
2: 1
3: 31
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045336058 Original CRISPR GCTGACGCCGCGGGACGCCC GGG (reversed) Intronic