ID: 1045336061

View in Genome Browser
Species Human (GRCh38)
Location 8:101205401-101205423
Sequence CGGGGGCGGTGCTGACGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045336061_1045336070 -2 Left 1045336061 8:101205401-101205423 CCGCGGCGTCAGCACCGCCCCCG 0: 1
1: 0
2: 1
3: 18
4: 266
Right 1045336070 8:101205422-101205444 CGCTGCCGCTCACCCGGGCCGGG 0: 1
1: 0
2: 1
3: 31
4: 187
1045336061_1045336064 -7 Left 1045336061 8:101205401-101205423 CCGCGGCGTCAGCACCGCCCCCG 0: 1
1: 0
2: 1
3: 18
4: 266
Right 1045336064 8:101205417-101205439 GCCCCCGCTGCCGCTCACCCGGG 0: 1
1: 0
2: 3
3: 42
4: 316
1045336061_1045336069 -3 Left 1045336061 8:101205401-101205423 CCGCGGCGTCAGCACCGCCCCCG 0: 1
1: 0
2: 1
3: 18
4: 266
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336061_1045336074 13 Left 1045336061 8:101205401-101205423 CCGCGGCGTCAGCACCGCCCCCG 0: 1
1: 0
2: 1
3: 18
4: 266
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336061_1045336063 -8 Left 1045336061 8:101205401-101205423 CCGCGGCGTCAGCACCGCCCCCG 0: 1
1: 0
2: 1
3: 18
4: 266
Right 1045336063 8:101205416-101205438 CGCCCCCGCTGCCGCTCACCCGG 0: 1
1: 1
2: 2
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045336061 Original CRISPR CGGGGGCGGTGCTGACGCCG CGG (reversed) Intronic