ID: 1045336069

View in Genome Browser
Species Human (GRCh38)
Location 8:101205421-101205443
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 151}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045336050_1045336069 21 Left 1045336050 8:101205377-101205399 CCCCCGCCCCGTTTCCCGGGCGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336051_1045336069 20 Left 1045336051 8:101205378-101205400 CCCCGCCCCGTTTCCCGGGCGTC 0: 1
1: 0
2: 1
3: 3
4: 85
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336060_1045336069 -2 Left 1045336060 8:101205400-101205422 CCCGCGGCGTCAGCACCGCCCCC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336054_1045336069 15 Left 1045336054 8:101205383-101205405 CCCCGTTTCCCGGGCGTCCCGCG 0: 1
1: 0
2: 0
3: 11
4: 58
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336057_1045336069 13 Left 1045336057 8:101205385-101205407 CCGTTTCCCGGGCGTCCCGCGGC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336052_1045336069 19 Left 1045336052 8:101205379-101205401 CCCGCCCCGTTTCCCGGGCGTCC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336061_1045336069 -3 Left 1045336061 8:101205401-101205423 CCGCGGCGTCAGCACCGCCCCCG 0: 1
1: 0
2: 1
3: 18
4: 266
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336055_1045336069 14 Left 1045336055 8:101205384-101205406 CCCGTTTCCCGGGCGTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336059_1045336069 6 Left 1045336059 8:101205392-101205414 CCGGGCGTCCCGCGGCGTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336058_1045336069 7 Left 1045336058 8:101205391-101205413 CCCGGGCGTCCCGCGGCGTCAGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336047_1045336069 25 Left 1045336047 8:101205373-101205395 CCGGCCCCCGCCCCGTTTCCCGG 0: 1
1: 1
2: 4
3: 63
4: 554
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151
1045336053_1045336069 18 Left 1045336053 8:101205380-101205402 CCGCCCCGTTTCCCGGGCGTCCC 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1045336069 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 0
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type