ID: 1045336074

View in Genome Browser
Species Human (GRCh38)
Location 8:101205437-101205459
Sequence GGGCCGGGACAGTCTTGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045336057_1045336074 29 Left 1045336057 8:101205385-101205407 CCGTTTCCCGGGCGTCCCGCGGC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336061_1045336074 13 Left 1045336061 8:101205401-101205423 CCGCGGCGTCAGCACCGCCCCCG 0: 1
1: 0
2: 1
3: 18
4: 266
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336067_1045336074 -6 Left 1045336067 8:101205420-101205442 CCCGCTGCCGCTCACCCGGGCCG 0: 1
1: 0
2: 1
3: 9
4: 205
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336055_1045336074 30 Left 1045336055 8:101205384-101205406 CCCGTTTCCCGGGCGTCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336060_1045336074 14 Left 1045336060 8:101205400-101205422 CCCGCGGCGTCAGCACCGCCCCC 0: 1
1: 0
2: 0
3: 17
4: 255
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336059_1045336074 22 Left 1045336059 8:101205392-101205414 CCGGGCGTCCCGCGGCGTCAGCA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336062_1045336074 -1 Left 1045336062 8:101205415-101205437 CCGCCCCCGCTGCCGCTCACCCG 0: 1
1: 0
2: 3
3: 53
4: 483
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336058_1045336074 23 Left 1045336058 8:101205391-101205413 CCCGGGCGTCCCGCGGCGTCAGC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336066_1045336074 -5 Left 1045336066 8:101205419-101205441 CCCCGCTGCCGCTCACCCGGGCC 0: 1
1: 0
2: 1
3: 21
4: 243
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336065_1045336074 -4 Left 1045336065 8:101205418-101205440 CCCCCGCTGCCGCTCACCCGGGC 0: 1
1: 0
2: 2
3: 36
4: 492
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71
1045336068_1045336074 -7 Left 1045336068 8:101205421-101205443 CCGCTGCCGCTCACCCGGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 210
Right 1045336074 8:101205437-101205459 GGGCCGGGACAGTCTTGCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045336074 Original CRISPR GGGCCGGGACAGTCTTGCGT CGG Intronic