ID: 1045342240

View in Genome Browser
Species Human (GRCh38)
Location 8:101265407-101265429
Sequence CTGGGTAGGGGGAAGCTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045342232_1045342240 23 Left 1045342232 8:101265361-101265383 CCCTACAAGTAAGTAAGTCACAC No data
Right 1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG No data
1045342233_1045342240 22 Left 1045342233 8:101265362-101265384 CCTACAAGTAAGTAAGTCACACT No data
Right 1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045342240 Original CRISPR CTGGGTAGGGGGAAGCTAGA TGG Intergenic
No off target data available for this crispr