ID: 1045342299

View in Genome Browser
Species Human (GRCh38)
Location 8:101265903-101265925
Sequence TAGGTAATCCACTTGGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045342293_1045342299 18 Left 1045342293 8:101265862-101265884 CCTGCTGTTCACTTCTCTAACTT No data
Right 1045342299 8:101265903-101265925 TAGGTAATCCACTTGGGTGTTGG No data
1045342295_1045342299 -8 Left 1045342295 8:101265888-101265910 CCTCCTCAGCTGTTCTAGGTAAT No data
Right 1045342299 8:101265903-101265925 TAGGTAATCCACTTGGGTGTTGG No data
1045342291_1045342299 25 Left 1045342291 8:101265855-101265877 CCCAATGCCTGCTGTTCACTTCT No data
Right 1045342299 8:101265903-101265925 TAGGTAATCCACTTGGGTGTTGG No data
1045342292_1045342299 24 Left 1045342292 8:101265856-101265878 CCAATGCCTGCTGTTCACTTCTC No data
Right 1045342299 8:101265903-101265925 TAGGTAATCCACTTGGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045342299 Original CRISPR TAGGTAATCCACTTGGGTGT TGG Intergenic
No off target data available for this crispr