ID: 1045342875

View in Genome Browser
Species Human (GRCh38)
Location 8:101270078-101270100
Sequence GCCTTGAAGAAAATAAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045342873_1045342875 11 Left 1045342873 8:101270044-101270066 CCTAAATTATATACTATTAATAT No data
Right 1045342875 8:101270078-101270100 GCCTTGAAGAAAATAAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045342875 Original CRISPR GCCTTGAAGAAAATAAACCA GGG Intergenic
No off target data available for this crispr