ID: 1045344204

View in Genome Browser
Species Human (GRCh38)
Location 8:101280106-101280128
Sequence GTGGTGATCTGGACTGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045344196_1045344204 10 Left 1045344196 8:101280073-101280095 CCACCTTCCTATCAGCAGAAAGA No data
Right 1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG No data
1045344197_1045344204 7 Left 1045344197 8:101280076-101280098 CCTTCCTATCAGCAGAAAGAGCC No data
Right 1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG No data
1045344198_1045344204 3 Left 1045344198 8:101280080-101280102 CCTATCAGCAGAAAGAGCCTTCT No data
Right 1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045344204 Original CRISPR GTGGTGATCTGGACTGCGGT GGG Intergenic
No off target data available for this crispr