ID: 1045345253

View in Genome Browser
Species Human (GRCh38)
Location 8:101288102-101288124
Sequence GAGCCGTAACCTTACATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045345248_1045345253 3 Left 1045345248 8:101288076-101288098 CCTTTTCAGGCTTGCTGTGGTGG No data
Right 1045345253 8:101288102-101288124 GAGCCGTAACCTTACATGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045345253 Original CRISPR GAGCCGTAACCTTACATGGG CGG Intergenic
No off target data available for this crispr