ID: 1045357381

View in Genome Browser
Species Human (GRCh38)
Location 8:101401912-101401934
Sequence CCTCAGAGACAGAATGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045357381_1045357388 2 Left 1045357381 8:101401912-101401934 CCCTCTGCATTCTGTCTCTGAGG No data
Right 1045357388 8:101401937-101401959 AGGATGGATCTATGTGGGTCAGG No data
1045357381_1045357386 -4 Left 1045357381 8:101401912-101401934 CCCTCTGCATTCTGTCTCTGAGG No data
Right 1045357386 8:101401931-101401953 GAGGACAGGATGGATCTATGTGG No data
1045357381_1045357389 19 Left 1045357381 8:101401912-101401934 CCCTCTGCATTCTGTCTCTGAGG No data
Right 1045357389 8:101401954-101401976 GTCAGGTCAATGACATTGACAGG No data
1045357381_1045357387 -3 Left 1045357381 8:101401912-101401934 CCCTCTGCATTCTGTCTCTGAGG No data
Right 1045357387 8:101401932-101401954 AGGACAGGATGGATCTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045357381 Original CRISPR CCTCAGAGACAGAATGCAGA GGG (reversed) Intergenic
No off target data available for this crispr