ID: 1045357387

View in Genome Browser
Species Human (GRCh38)
Location 8:101401932-101401954
Sequence AGGACAGGATGGATCTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045357380_1045357387 -2 Left 1045357380 8:101401911-101401933 CCCCTCTGCATTCTGTCTCTGAG No data
Right 1045357387 8:101401932-101401954 AGGACAGGATGGATCTATGTGGG No data
1045357378_1045357387 0 Left 1045357378 8:101401909-101401931 CCCCCCTCTGCATTCTGTCTCTG No data
Right 1045357387 8:101401932-101401954 AGGACAGGATGGATCTATGTGGG No data
1045357381_1045357387 -3 Left 1045357381 8:101401912-101401934 CCCTCTGCATTCTGTCTCTGAGG No data
Right 1045357387 8:101401932-101401954 AGGACAGGATGGATCTATGTGGG No data
1045357379_1045357387 -1 Left 1045357379 8:101401910-101401932 CCCCCTCTGCATTCTGTCTCTGA No data
Right 1045357387 8:101401932-101401954 AGGACAGGATGGATCTATGTGGG No data
1045357377_1045357387 24 Left 1045357377 8:101401885-101401907 CCTCTCTGGCTGCAGCACTTTAA No data
Right 1045357387 8:101401932-101401954 AGGACAGGATGGATCTATGTGGG No data
1045357383_1045357387 -4 Left 1045357383 8:101401913-101401935 CCTCTGCATTCTGTCTCTGAGGA No data
Right 1045357387 8:101401932-101401954 AGGACAGGATGGATCTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045357387 Original CRISPR AGGACAGGATGGATCTATGT GGG Intergenic
No off target data available for this crispr