ID: 1045358695

View in Genome Browser
Species Human (GRCh38)
Location 8:101412432-101412454
Sequence CCTGATATGGGGAGACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045358695_1045358705 10 Left 1045358695 8:101412432-101412454 CCTTCCAGTCTCCCCATATCAGG No data
Right 1045358705 8:101412465-101412487 GAAAGAAGAAAAGCAAGCAGTGG No data
1045358695_1045358706 11 Left 1045358695 8:101412432-101412454 CCTTCCAGTCTCCCCATATCAGG No data
Right 1045358706 8:101412466-101412488 AAAGAAGAAAAGCAAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045358695 Original CRISPR CCTGATATGGGGAGACTGGA AGG (reversed) Intergenic
No off target data available for this crispr