ID: 1045360955

View in Genome Browser
Species Human (GRCh38)
Location 8:101432782-101432804
Sequence CAGGTTACTCCACTTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045360952_1045360955 -8 Left 1045360952 8:101432767-101432789 CCATTTGTCTACCCTCAGGTTAC No data
Right 1045360955 8:101432782-101432804 CAGGTTACTCCACTTAAAATAGG No data
1045360950_1045360955 -4 Left 1045360950 8:101432763-101432785 CCAGCCATTTGTCTACCCTCAGG No data
Right 1045360955 8:101432782-101432804 CAGGTTACTCCACTTAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045360955 Original CRISPR CAGGTTACTCCACTTAAAAT AGG Intergenic
No off target data available for this crispr