ID: 1045362131

View in Genome Browser
Species Human (GRCh38)
Location 8:101442547-101442569
Sequence ATTCTCTTCTGGGGCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045362131_1045362138 3 Left 1045362131 8:101442547-101442569 CCTGTCCTGCCCCAGAAGAGAAT No data
Right 1045362138 8:101442573-101442595 AGTCTACCTCATTTGGCCAAGGG No data
1045362131_1045362142 13 Left 1045362131 8:101442547-101442569 CCTGTCCTGCCCCAGAAGAGAAT No data
Right 1045362142 8:101442583-101442605 ATTTGGCCAAGGGCTTTGGTGGG No data
1045362131_1045362140 9 Left 1045362131 8:101442547-101442569 CCTGTCCTGCCCCAGAAGAGAAT No data
Right 1045362140 8:101442579-101442601 CCTCATTTGGCCAAGGGCTTTGG No data
1045362131_1045362136 -4 Left 1045362131 8:101442547-101442569 CCTGTCCTGCCCCAGAAGAGAAT No data
Right 1045362136 8:101442566-101442588 GAATGAGAGTCTACCTCATTTGG No data
1045362131_1045362143 14 Left 1045362131 8:101442547-101442569 CCTGTCCTGCCCCAGAAGAGAAT No data
Right 1045362143 8:101442584-101442606 TTTGGCCAAGGGCTTTGGTGGGG No data
1045362131_1045362137 2 Left 1045362131 8:101442547-101442569 CCTGTCCTGCCCCAGAAGAGAAT No data
Right 1045362137 8:101442572-101442594 GAGTCTACCTCATTTGGCCAAGG No data
1045362131_1045362141 12 Left 1045362131 8:101442547-101442569 CCTGTCCTGCCCCAGAAGAGAAT No data
Right 1045362141 8:101442582-101442604 CATTTGGCCAAGGGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045362131 Original CRISPR ATTCTCTTCTGGGGCAGGAC AGG (reversed) Intergenic
No off target data available for this crispr