ID: 1045362991

View in Genome Browser
Species Human (GRCh38)
Location 8:101450107-101450129
Sequence AGGAAGTGCTGTCATCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045362991_1045362998 10 Left 1045362991 8:101450107-101450129 CCTGGATGATGACAGCACTTCCT No data
Right 1045362998 8:101450140-101450162 GCAAAAAGTCCCTTCCTGAAGGG No data
1045362991_1045363003 22 Left 1045362991 8:101450107-101450129 CCTGGATGATGACAGCACTTCCT No data
Right 1045363003 8:101450152-101450174 TTCCTGAAGGGGGAGTTGAGTGG No data
1045362991_1045362997 9 Left 1045362991 8:101450107-101450129 CCTGGATGATGACAGCACTTCCT No data
Right 1045362997 8:101450139-101450161 GGCAAAAAGTCCCTTCCTGAAGG No data
1045362991_1045362999 11 Left 1045362991 8:101450107-101450129 CCTGGATGATGACAGCACTTCCT No data
Right 1045362999 8:101450141-101450163 CAAAAAGTCCCTTCCTGAAGGGG No data
1045362991_1045363000 12 Left 1045362991 8:101450107-101450129 CCTGGATGATGACAGCACTTCCT No data
Right 1045363000 8:101450142-101450164 AAAAAGTCCCTTCCTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045362991 Original CRISPR AGGAAGTGCTGTCATCATCC AGG (reversed) Intergenic
No off target data available for this crispr