ID: 1045362996

View in Genome Browser
Species Human (GRCh38)
Location 8:101450127-101450149
Sequence GACTTTTTGCCCCCAGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045362996_1045363005 24 Left 1045362996 8:101450127-101450149 CCTGCATCTGGGGGCAAAAAGTC No data
Right 1045363005 8:101450174-101450196 GCACATCACTGTGACTGCTATGG No data
1045362996_1045363006 30 Left 1045362996 8:101450127-101450149 CCTGCATCTGGGGGCAAAAAGTC No data
Right 1045363006 8:101450180-101450202 CACTGTGACTGCTATGGCCAAGG No data
1045362996_1045362999 -9 Left 1045362996 8:101450127-101450149 CCTGCATCTGGGGGCAAAAAGTC No data
Right 1045362999 8:101450141-101450163 CAAAAAGTCCCTTCCTGAAGGGG No data
1045362996_1045362998 -10 Left 1045362996 8:101450127-101450149 CCTGCATCTGGGGGCAAAAAGTC No data
Right 1045362998 8:101450140-101450162 GCAAAAAGTCCCTTCCTGAAGGG No data
1045362996_1045363000 -8 Left 1045362996 8:101450127-101450149 CCTGCATCTGGGGGCAAAAAGTC No data
Right 1045363000 8:101450142-101450164 AAAAAGTCCCTTCCTGAAGGGGG No data
1045362996_1045363003 2 Left 1045362996 8:101450127-101450149 CCTGCATCTGGGGGCAAAAAGTC No data
Right 1045363003 8:101450152-101450174 TTCCTGAAGGGGGAGTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045362996 Original CRISPR GACTTTTTGCCCCCAGATGC AGG (reversed) Intergenic
No off target data available for this crispr