ID: 1045363003

View in Genome Browser
Species Human (GRCh38)
Location 8:101450152-101450174
Sequence TTCCTGAAGGGGGAGTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045362991_1045363003 22 Left 1045362991 8:101450107-101450129 CCTGGATGATGACAGCACTTCCT No data
Right 1045363003 8:101450152-101450174 TTCCTGAAGGGGGAGTTGAGTGG No data
1045362996_1045363003 2 Left 1045362996 8:101450127-101450149 CCTGCATCTGGGGGCAAAAAGTC No data
Right 1045363003 8:101450152-101450174 TTCCTGAAGGGGGAGTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045363003 Original CRISPR TTCCTGAAGGGGGAGTTGAG TGG Intergenic
No off target data available for this crispr