ID: 1045367701

View in Genome Browser
Species Human (GRCh38)
Location 8:101492520-101492542
Sequence CGAGCTCGGAGGCGGCCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045367701_1045367709 -9 Left 1045367701 8:101492520-101492542 CCGCCCGGCCGCCTCCGAGCTCG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1045367709 8:101492534-101492556 CCGAGCTCGGGCCCCATGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 89
1045367701_1045367710 -8 Left 1045367701 8:101492520-101492542 CCGCCCGGCCGCCTCCGAGCTCG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1045367710 8:101492535-101492557 CGAGCTCGGGCCCCATGTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 47
1045367701_1045367724 27 Left 1045367701 8:101492520-101492542 CCGCCCGGCCGCCTCCGAGCTCG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1045367724 8:101492570-101492592 CCCACCTTTCCGGCTAGGTGAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1045367701_1045367726 28 Left 1045367701 8:101492520-101492542 CCGCCCGGCCGCCTCCGAGCTCG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1045367726 8:101492571-101492593 CCACCTTTCCGGCTAGGTGAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1045367701_1045367722 22 Left 1045367701 8:101492520-101492542 CCGCCCGGCCGCCTCCGAGCTCG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1045367722 8:101492565-101492587 CTTATCCCACCTTTCCGGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1045367701_1045367717 17 Left 1045367701 8:101492520-101492542 CCGCCCGGCCGCCTCCGAGCTCG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1045367717 8:101492560-101492582 CCCCCCTTATCCCACCTTTCCGG 0: 1
1: 0
2: 1
3: 14
4: 247
1045367701_1045367711 -7 Left 1045367701 8:101492520-101492542 CCGCCCGGCCGCCTCCGAGCTCG 0: 1
1: 0
2: 3
3: 11
4: 170
Right 1045367711 8:101492536-101492558 GAGCTCGGGCCCCATGTGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045367701 Original CRISPR CGAGCTCGGAGGCGGCCGGG CGG (reversed) Exonic
900091970 1:924569-924591 CGGGCAGCGAGGCGGCCGGGGGG - Intergenic
900113572 1:1019663-1019685 AGGGCTCGAAGGCCGCCGGGAGG - Intergenic
900300357 1:1973879-1973901 CAAGCTGGGAGGAGGCAGGGAGG + Intronic
902799002 1:18818026-18818048 CTAGCTCAGCGGCTGCCGGGTGG - Intergenic
903016801 1:20366719-20366741 AGCGCGCGGAGGCTGCCGGGAGG - Intergenic
903044244 1:20553707-20553729 CTCGCTCGGCGGCGGCCGGTAGG - Exonic
903155609 1:21440442-21440464 CGAGCGCGGGGGCGGGTGGGAGG + Intronic
903652316 1:24929740-24929762 TGAGCGCGCAGGCGGCCGTGGGG - Exonic
903898061 1:26621528-26621550 AGAGCAAGGAGGCGGCGGGGCGG - Intergenic
904822761 1:33256262-33256284 CGAGAGGGGAGGGGGCCGGGCGG - Intergenic
905038054 1:34929983-34930005 CAAGCCCGGCGGCGGGCGGGCGG + Intergenic
911227065 1:95318104-95318126 CCAGCTGGGAGGTGGCTGGGAGG - Intergenic
912167425 1:107057267-107057289 AGAGCTCGGCGGAGGCCGGCAGG - Exonic
915458073 1:156053712-156053734 CGGGCTGGCGGGCGGCCGGGTGG - Exonic
919860967 1:201739461-201739483 GGAGCCAGGAGGAGGCCGGGAGG + Intronic
919862587 1:201750785-201750807 TGAGATCGGAGGAGGCCTGGAGG + Intronic
920171184 1:204073445-204073467 CGAGCTTGGTTCCGGCCGGGCGG - Intronic
920204703 1:204283016-204283038 AGAGCTGGAAGGCGGCGGGGCGG - Intronic
920917910 1:210272911-210272933 GGAGCTGGCAGGAGGCCGGGAGG - Intergenic
922224395 1:223632777-223632799 CTAGCTCGAAGGTGGCCAGGAGG - Intronic
923007906 1:230067041-230067063 CGGCCTCGGAGGCGGCGAGGGGG - Intronic
924042483 1:239997714-239997736 CGGGCTCGGCGCGGGCCGGGAGG - Intergenic
1068690308 10:59906877-59906899 CGAGCCCGGAAGAGGCTGGGCGG - Intergenic
1069695505 10:70382617-70382639 CGAGTTCCGAGCCGGCGGGGCGG + Intronic
1070179096 10:73997795-73997817 CGAGGCGGGAGGCGGCCCGGGGG + Intergenic
1072190526 10:93073610-93073632 TGAGCTCCGAGGCGGCGGTGGGG - Intronic
1074824171 10:117202651-117202673 CCAGCTTAGAGGCGGCTGGGAGG - Intronic
1075504211 10:123008410-123008432 GGAGCTCGGAGGCTCCGGGGCGG - Intronic
1075802016 10:125159929-125159951 CGAGCGCGGCGGCGTCCGGAGGG - Intronic
1076721976 10:132396859-132396881 CGAGCCCGGGGGCGGCGGGGGGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1081845573 11:46238275-46238297 GGAGCCTGGAGGGGGCCGGGAGG - Intergenic
1081870805 11:46381782-46381804 CTAGATCGGCCGCGGCCGGGCGG - Intronic
1083289208 11:61680483-61680505 CGAGCCCTGCGGCGGGCGGGAGG + Exonic
1083933480 11:65858324-65858346 GCAGCTCGGAGCCGGCCGGCGGG - Exonic
1084421580 11:69063184-69063206 CTAGCTCGAAGGCTGCTGGGAGG - Intronic
1084606880 11:70177426-70177448 GGAGGTCGGAGGTCGCCGGGAGG + Intronic
1085443318 11:76582506-76582528 CGGACTGGGTGGCGGCCGGGCGG + Intergenic
1086341523 11:85853054-85853076 CGGACGGGGAGGCGGCCGGGCGG - Intergenic
1088645354 11:111912856-111912878 CGTACTCGGCGGTGGCCGGGTGG - Exonic
1089622419 11:119729407-119729429 CCAGCTGGAAGGCGGCCGAGGGG - Intergenic
1091587280 12:1823428-1823450 CGTGCTCTGAGGGGGCCGAGTGG + Intronic
1093894700 12:24562784-24562806 GGAGCTCGGGGGCGACCTGGAGG - Intergenic
1097228551 12:57495108-57495130 CGGGCTGGGTGGCGGCCAGGCGG + Intronic
1104761487 12:131299716-131299738 TGAGCTCGTAGGCGTTCGGGGGG + Intergenic
1104818289 12:131661076-131661098 TGAGCTCGTAGGCGTTCGGGGGG - Intergenic
1104961112 12:132489253-132489275 CGAGCTCGGAGGGGCCCGCCTGG - Intergenic
1108292731 13:48976664-48976686 CAAGTTCGGCGGCTGCCGGGCGG - Exonic
1110318573 13:74135480-74135502 AGAGGGAGGAGGCGGCCGGGCGG + Intergenic
1113439070 13:110313854-110313876 CGAGGTAGGAGCCTGCCGGGTGG - Intronic
1113485298 13:110648605-110648627 CGAGGTCGGAGGTGGCCTTGAGG - Intronic
1114659349 14:24334808-24334830 CGGGCTGGGAGGCCGCAGGGAGG - Intronic
1114736762 14:25050171-25050193 CATGCTCAGAGGCGGCCGCGCGG - Exonic
1118359689 14:65045418-65045440 CCATCTCGGGGGCGGCGGGGAGG - Intronic
1122145131 14:99684359-99684381 CGGGCGCCGAGGGGGCCGGGAGG - Exonic
1124251073 15:28106857-28106879 CAGGCCCGGAGGCGGCCGCGGGG - Intergenic
1125546702 15:40511555-40511577 CAAGCTCCGAGGCGGGCTGGGGG + Intergenic
1126736620 15:51737536-51737558 CGAGCGCGGCGGCGGCGAGGGGG + Exonic
1126827805 15:52568986-52569008 CGCGGGCGGAGGCGGCCCGGCGG - Intronic
1130250743 15:82298858-82298880 CGAGCTCGAGGGTGGCCTGGCGG + Intergenic
1132055868 15:98649781-98649803 CGGGCTCGGGAGCGGCGGGGTGG + Intronic
1132498833 16:275868-275890 TGCGCCCGGGGGCGGCCGGGGGG + Exonic
1132499894 16:280612-280634 CGAGCGGGGCGGCGGCGGGGCGG + Exonic
1132835541 16:1951098-1951120 CCAGCTCAGAGGCCTCCGGGTGG - Intronic
1132847936 16:2009325-2009347 GGAGGCCGGAGGCGGCCGAGCGG - Intronic
1133304931 16:4802715-4802737 CGAGCACGGAGCCGGCCTGGGGG - Exonic
1133362623 16:5186450-5186472 AGCGCACGGAGGCGGCGGGGAGG + Intergenic
1136498870 16:30659798-30659820 CGAGCTCGGAAGCGGCCTGCCGG + Exonic
1138567834 16:57846355-57846377 CCAGGTTGGAGGCAGCCGGGAGG - Intronic
1141841259 16:86575795-86575817 CGAGCTGGGAGACGGCCGGGCGG - Intergenic
1143520022 17:7439668-7439690 CGAGCCCGGGGGCAGCCGGCCGG + Exonic
1144207996 17:12992886-12992908 GGAGCTGGCAGGCGGCCTGGAGG - Exonic
1144519441 17:15944550-15944572 CTCGCTGGGAGGCGGCCGGAGGG + Intergenic
1146922409 17:36722478-36722500 CCAGCTCGTAGGGGGCTGGGCGG + Intergenic
1148000673 17:44385387-44385409 CGAGCCCGGAGGAGGGCTGGGGG + Intronic
1151662362 17:75525609-75525631 CGAGCTGGGGGGCGGGCCGGGGG + Intronic
1152597277 17:81243878-81243900 GGGGCTGGGAGGGGGCCGGGAGG - Intergenic
1152617534 17:81344967-81344989 CGGGGTCCGAGGAGGCCGGGTGG - Intergenic
1152617545 17:81344996-81345018 CGGGGTCCGAGGAGGCCGGGTGG - Intergenic
1152617556 17:81345025-81345047 CGGGGTCCGAGGAGGCCGGGTGG - Intergenic
1152617569 17:81345054-81345076 CGGGGTCCGAGGAGGCCGGGTGG - Intergenic
1152697419 17:81804073-81804095 CGGGCTCGGGGGCGGCCCCGCGG - Intergenic
1152697511 17:81804345-81804367 GGAGCGGGGAGCCGGCCGGGCGG + Intronic
1154327744 18:13404156-13404178 AGAGCTGGGAGGCGCCCTGGAGG + Intronic
1156316287 18:35972234-35972256 CCAGCAACGAGGCGGCCGGGAGG - Exonic
1157799701 18:50609320-50609342 CGGGCGGGGCGGCGGCCGGGCGG + Intronic
1157842037 18:50967949-50967971 CGCGCTCGGTGGCGCCCGCGCGG - Intergenic
1160930165 19:1566678-1566700 CGAGCTGCGGGGCGGGCGGGCGG - Intronic
1161001293 19:1912481-1912503 CCTGGTCAGAGGCGGCCGGGCGG - Exonic
1161560284 19:4969248-4969270 CGCGCTCGGACACGGCCGGGCGG - Intronic
1162413412 19:10519518-10519540 GGAACTCGGAGGAGCCCGGGAGG - Intergenic
1162496635 19:11026886-11026908 AGAGCTTGGAGGCGGCAGAGTGG - Intronic
1163503222 19:17688205-17688227 CGAGCTCGCAGGTGGGCCGGAGG + Intronic
1163673792 19:18645181-18645203 CGAGCTGGGAGGAGGCCAGCTGG - Intronic
1165749437 19:38251276-38251298 CAAGCTGGGCGGCGTCCGGGGGG + Exonic
1167049173 19:47068255-47068277 CCAGCCCGGAGGTGGGCGGGAGG - Intronic
1167269531 19:48499340-48499362 GGACCTCGGAGGGGGCCTGGGGG + Exonic
1167502842 19:49857253-49857275 GGAGCCCGGAGGATGCCGGGCGG + Intronic
1168339653 19:55615772-55615794 GGCGCTCGGGGGCGGCCTGGTGG - Exonic
1168347012 19:55654901-55654923 CAAGCTCGCGGGCGGGCGGGCGG + Intronic
929808684 2:45170021-45170043 CGAGCTGGGAGCCGGGCGAGAGG - Intergenic
931252931 2:60549996-60550018 CGAGCTCCGAGGCGAGAGGGGGG + Intronic
931253850 2:60554146-60554168 CGAGCGCGGCGGCGGCGGGGAGG - Intergenic
934978732 2:98823249-98823271 CGAGCTCCGGGGTGGCCGGGCGG + Exonic
937963960 2:127486812-127486834 CTAGCTGGGAGGCGGCAGGAGGG - Intronic
938034759 2:128027263-128027285 CGAGCACAGCGGCGGCCGGGTGG - Exonic
938133697 2:128737091-128737113 CCCGCCCGGAGGCGGCCGCGCGG - Intergenic
944433214 2:199659345-199659367 CGCGCCCGGCGGCGGCTGGGGGG - Intergenic
944699977 2:202238216-202238238 CGAGCCCGGAGAGGGGCGGGCGG + Intronic
944766792 2:202872046-202872068 GGTGCTCGGAGGGAGCCGGGAGG - Intergenic
948175292 2:235938363-235938385 CGTTCTTGGAGGCGGTCGGGTGG - Intronic
1169005932 20:2207359-2207381 AGAGCGCGGAGGCGGCCACGCGG - Intergenic
1169129682 20:3159659-3159681 CCAGCTCTGGGCCGGCCGGGAGG + Intronic
1172841078 20:37903126-37903148 CGCAGTCGGAGGCGGCCGGCTGG + Exonic
1174258546 20:49277396-49277418 TGAGGACGGAGGCGGCGGGGTGG + Intronic
1175267089 20:57709614-57709636 GGGGCTCGGGGGCGGCCGGGGGG + Exonic
1176159568 20:63641490-63641512 CCAGCCCGGATGAGGCCGGGCGG - Intronic
1176219253 20:63962251-63962273 CGTGAGCGGAGGCAGCCGGGTGG - Exonic
1176366117 21:6033924-6033946 CGAGCTCCGGGGCAGGCGGGCGG + Intergenic
1176388212 21:6150330-6150352 CGAGCTCTTAGGCTCCCGGGGGG + Intergenic
1179674795 21:42974326-42974348 CGCGCTCGGGCGCGGCCGGTTGG + Intergenic
1179735260 21:43387918-43387940 CGAGCTCTTAGGCTCCCGGGGGG - Intergenic
1179757400 21:43504621-43504643 CGAGCTCCGGGGCAGGCGGGCGG - Intergenic
1182278603 22:29205782-29205804 GGAGCCCGGAGGGGCCCGGGCGG - Intergenic
1183708421 22:39488864-39488886 GGAGCACGGCGGCGGGCGGGTGG + Exonic
1184412413 22:44332662-44332684 GGAGCTGGGGGGCTGCCGGGTGG - Intergenic
1184600588 22:45541067-45541089 CCAGCTGGGAGGCGGCTGTGTGG + Intronic
1185349400 22:50326778-50326800 CGAGCGCGGGCGCGGGCGGGTGG - Intronic
950438451 3:12994062-12994084 CGAGGTAGGAGGCGGGCCGGCGG - Intronic
950518129 3:13480415-13480437 CGAGGGCGGGGACGGCCGGGCGG + Intronic
960960435 3:123067091-123067113 GGAGCTAGCAGGCGGGCGGGCGG + Exonic
961594542 3:128006400-128006422 CCAGCTGGGAGGCAGGCGGGAGG + Intergenic
963732642 3:148987677-148987699 CGGGCTGGCGGGCGGCCGGGTGG - Intergenic
966440815 3:179942416-179942438 GGACCGCGGAGGCGGCTGGGCGG + Intronic
967858181 3:194134088-194134110 CGAGCTCCCAGGCGGCGGGAAGG + Intergenic
968479140 4:826174-826196 CACGCTCGGACGCGGGCGGGGGG - Exonic
968729124 4:2261538-2261560 CGAGGGCGGGGCCGGCCGGGCGG + Intronic
980230241 4:130038718-130038740 CGAGCTCGGCGCCGGCGGGCTGG + Intergenic
993520053 5:88889456-88889478 AGAGCTCGGAGGCTGCTGGTAGG + Intronic
994907506 5:105859604-105859626 CGTACGGGGAGGCGGCCGGGTGG - Intergenic
997990723 5:138542832-138542854 AGAGCTTGGAGGCGGCCCGCGGG - Exonic
1002196291 5:177503473-177503495 CGAGCTGGGAGGAGGCAGTGGGG - Intronic
1004614966 6:17281098-17281120 CGAGCGCCGAAGCGGGCGGGGGG - Intergenic
1007479859 6:42142664-42142686 GGAGCTGGGCGGCGGCGGGGCGG - Intergenic
1013272690 6:108558639-108558661 GGAGCCCGGAGGCGGCTGGGCGG + Intergenic
1013538757 6:111087574-111087596 CCAGCGCGCAGGCGGCCGCGAGG - Exonic
1015625939 6:135181197-135181219 CGACCGCGGAGGCGGCGGGCAGG + Intergenic
1016454557 6:144216818-144216840 CGGGGCGGGAGGCGGCCGGGAGG + Intergenic
1020224955 7:6272582-6272604 GGAGCGCGCAGGCGACCGGGCGG + Exonic
1022339821 7:29457388-29457410 GGAGCTCTGAGACGGCCTGGGGG - Intronic
1024521029 7:50304338-50304360 CGATCCGGGAGGCGGCCGAGAGG + Intronic
1026889810 7:73975200-73975222 CCAGCTCAGAGTTGGCCGGGAGG - Intergenic
1028136735 7:87230468-87230490 GGAGCTCGGAAGAGGCCTGGAGG + Intergenic
1028417465 7:90595942-90595964 GGAGCGCGGGGGCGGCCGGGAGG + Intronic
1029494535 7:100889872-100889894 CGAGCTCCGAGGCGGGCGCAAGG - Intergenic
1032306193 7:130734041-130734063 GGCGCTCGCCGGCGGCCGGGCGG - Exonic
1033390623 7:140924522-140924544 CGAGCCCGGAGTCGGGAGGGCGG + Intronic
1033406165 7:141073182-141073204 CGGGTCCGGAGGCGGTCGGGTGG + Intergenic
1037877333 8:22554516-22554538 CCAGCGCGGAGGCTGCGGGGTGG - Exonic
1040065393 8:43140636-43140658 TGCGCTCGTAGCCGGCCGGGCGG - Intronic
1043873882 8:85463937-85463959 CGTGCTCGGGGGCGGCCCGGGGG - Exonic
1045367701 8:101492520-101492542 CGAGCTCGGAGGCGGCCGGGCGG - Exonic
1045847675 8:106657555-106657577 CGAGCGCGGACGGGGCGGGGAGG + Intronic
1049503087 8:142978502-142978524 CGAGCTGTGAGGCTGCTGGGTGG + Intergenic
1049660026 8:143815735-143815757 CGGGCTGCGCGGCGGCCGGGTGG - Intergenic
1049808263 8:144551217-144551239 GGGGCTGGCAGGCGGCCGGGAGG + Intronic
1053129078 9:35605305-35605327 CGCGGGCGGAGGCGGGCGGGCGG - Exonic
1053175273 9:35917877-35917899 AGAGCTCTCTGGCGGCCGGGTGG - Intergenic
1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG + Intronic
1060734607 9:126059082-126059104 GGAGCTGGGAGGCGGCAGTGAGG - Intergenic
1061015994 9:127981011-127981033 CGTGCTCGGCGGCGGCTAGGCGG - Intergenic
1061571868 9:131482789-131482811 AGGGCTCGGAGGGGGCCGAGCGG + Exonic
1061680850 9:132241812-132241834 GGAGCTCGGAGGTTGGCGGGGGG + Intronic
1062107071 9:134761535-134761557 CGAGCTCTGAGGCTGCAGGCAGG + Intronic
1062567194 9:137168548-137168570 CGAGGGCGGGGGCGGGCGGGTGG - Exonic
1062656185 9:137605522-137605544 CGGGCTACGGGGCGGCCGGGGGG + Intergenic
1062656338 9:137605970-137605992 CGGGCTCGGCGGCGCCGGGGAGG + Intronic
1203788381 EBV:140770-140792 GGAGCTCGGGGGCGGCCGGGTGG + Intergenic
1186200138 X:7148238-7148260 CGGGCTCGGAGCCGGGCGAGGGG - Intergenic
1189262558 X:39688960-39688982 CGCGCTCGGAGCCAGCAGGGCGG + Intergenic
1190261669 X:48801661-48801683 CGAGCTCACAGGCGACGGGGCGG - Intronic
1190261680 X:48801723-48801745 CGAGCTCACAAGCGGCGGGGCGG - Intronic
1199760286 X:150899284-150899306 CGAGGCCGGGGGCGCCCGGGTGG + Intergenic
1200061661 X:153486442-153486464 CGAGTTGGGAGGGGGCCAGGAGG + Intronic
1200084875 X:153599162-153599184 CGGGGCCGGACGCGGCCGGGTGG - Exonic