ID: 1045368069

View in Genome Browser
Species Human (GRCh38)
Location 8:101494036-101494058
Sequence GCGTCCTATTGGAAGTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045368058_1045368069 14 Left 1045368058 8:101493999-101494021 CCCTCCTCTCGGGCGCGTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368056_1045368069 15 Left 1045368056 8:101493998-101494020 CCCCTCCTCTCGGGCGCGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368055_1045368069 16 Left 1045368055 8:101493997-101494019 CCCCCTCCTCTCGGGCGCGTCCG 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368054_1045368069 20 Left 1045368054 8:101493993-101494015 CCTTCCCCCTCCTCTCGGGCGCG 0: 1
1: 0
2: 0
3: 34
4: 190
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368066_1045368069 -9 Left 1045368066 8:101494022-101494044 CCTGGGAACTGGCTGCGTCCTAT 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368060_1045368069 13 Left 1045368060 8:101494000-101494022 CCTCCTCTCGGGCGCGTCCGGGC 0: 1
1: 0
2: 1
3: 3
4: 90
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368061_1045368069 10 Left 1045368061 8:101494003-101494025 CCTCTCGGGCGCGTCCGGGCCTG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368053_1045368069 21 Left 1045368053 8:101493992-101494014 CCCTTCCCCCTCCTCTCGGGCGC 0: 1
1: 0
2: 3
3: 27
4: 294
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data
1045368065_1045368069 -4 Left 1045368065 8:101494017-101494039 CCGGGCCTGGGAACTGGCTGCGT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045368069 Original CRISPR GCGTCCTATTGGAAGTGCGC GGG Intronic
No off target data available for this crispr