ID: 1045370339

View in Genome Browser
Species Human (GRCh38)
Location 8:101516445-101516467
Sequence CCCTCCAGCCTGGCCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045370339_1045370344 -2 Left 1045370339 8:101516445-101516467 CCCTCTGTGGCCAGGCTGGAGGG No data
Right 1045370344 8:101516466-101516488 GGAGTGCAATGGTGTGATTATGG No data
1045370339_1045370345 23 Left 1045370339 8:101516445-101516467 CCCTCTGTGGCCAGGCTGGAGGG No data
Right 1045370345 8:101516491-101516513 TACTGCAACCTCGATCTCCCAGG No data
1045370339_1045370346 30 Left 1045370339 8:101516445-101516467 CCCTCTGTGGCCAGGCTGGAGGG No data
Right 1045370346 8:101516498-101516520 ACCTCGATCTCCCAGGCTCAAGG 0: 1
1: 20
2: 272
3: 1440
4: 4306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045370339 Original CRISPR CCCTCCAGCCTGGCCACAGA GGG (reversed) Intronic