ID: 1045371460

View in Genome Browser
Species Human (GRCh38)
Location 8:101528543-101528565
Sequence ATGTGCCCTCATTGCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045371457_1045371460 -3 Left 1045371457 8:101528523-101528545 CCCACATGTAGCTGGGGAACATG 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1045371460 8:101528543-101528565 ATGTGCCCTCATTGCAAGGCAGG No data
1045371458_1045371460 -4 Left 1045371458 8:101528524-101528546 CCACATGTAGCTGGGGAACATGT 0: 1
1: 0
2: 2
3: 10
4: 160
Right 1045371460 8:101528543-101528565 ATGTGCCCTCATTGCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045371460 Original CRISPR ATGTGCCCTCATTGCAAGGC AGG Intronic
No off target data available for this crispr