ID: 1045378443

View in Genome Browser
Species Human (GRCh38)
Location 8:101599445-101599467
Sequence CTGCACAGAGACGCCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378443_1045378448 0 Left 1045378443 8:101599445-101599467 CCCCCAAAGGCGTCTCTGTGCAG 0: 1
1: 0
2: 3
3: 14
4: 115
Right 1045378448 8:101599468-101599490 CCTCCTCTAGACACAGAGAGAGG No data
1045378443_1045378450 25 Left 1045378443 8:101599445-101599467 CCCCCAAAGGCGTCTCTGTGCAG 0: 1
1: 0
2: 3
3: 14
4: 115
Right 1045378450 8:101599493-101599515 CTCAGAGCTGATGTCTTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045378443 Original CRISPR CTGCACAGAGACGCCTTTGG GGG (reversed) Intronic
900369985 1:2327971-2327993 CTGCACACAGAAGCCTGTGACGG - Intronic
902799123 1:18818516-18818538 CTGCAGAGAGGTGGCTTTGGGGG - Intergenic
904769647 1:32873650-32873672 CTCCACAGAGACCCCCTTGAGGG + Intergenic
905136434 1:35804139-35804161 CATCACAGAGCCTCCTTTGGGGG - Intergenic
907426723 1:54384385-54384407 CTGCACAGAGGGGCCCTGGGAGG + Intronic
914825418 1:151135575-151135597 CTGCCCGGTGAGGCCTTTGGAGG - Exonic
917265940 1:173220985-173221007 CTCCACAGAGAGGCCTTTGATGG - Intergenic
919932789 1:202232325-202232347 CTGGCCAGAGAGGCATTTGGGGG - Intronic
920350026 1:205331762-205331784 CTGAACAAAGGGGCCTTTGGGGG - Intergenic
921772115 1:219052695-219052717 AAGCACAGAAACGCCTTTAGGGG + Intergenic
924394727 1:243606827-243606849 CTGCACAGAGCCGGGTTGGGGGG - Intronic
1066628351 10:37432814-37432836 CTGGACACAGACCCCTTTTGGGG - Intergenic
1067727251 10:48779550-48779572 CTCCACAGAGACTCCATTGTAGG - Intronic
1067998664 10:51305397-51305419 CTGCACAGAAAAGCTGTTGGGGG + Intronic
1075351456 10:121728598-121728620 CTGAACGGAGACGCCCTTTGTGG + Intergenic
1077791575 11:5446745-5446767 CTGGACAGAGAGTCCTGTGGGGG - Intronic
1080494716 11:32805818-32805840 CTCCACAGAGAAGCACTTGGTGG - Intergenic
1082013423 11:47466826-47466848 CTGCACAGAGCCGCCTCTGTTGG - Intronic
1084531604 11:69730951-69730973 CTGCAGAGTGAAGCCTGTGGAGG + Intergenic
1084770646 11:71340903-71340925 ATGCAAAGAGACCCCTTAGGAGG - Intergenic
1084781920 11:71415472-71415494 GTGCACAGAGATGCCCTTGGGGG + Intergenic
1085773180 11:79342599-79342621 CTGCACAGAGAATCACTTGGGGG + Intronic
1089070049 11:115692830-115692852 CTGGACAAAGAAGACTTTGGTGG + Intergenic
1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG + Intronic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1094190953 12:27697983-27698005 CTGCACTGAGAGGACTTTGATGG + Intergenic
1094404453 12:30100439-30100461 CTGCACAGGGAAACTTTTGGAGG - Intergenic
1095073427 12:37887130-37887152 GTGCACATAGAGGCCTGTGGTGG - Intergenic
1097765674 12:63523885-63523907 CTGCACAGAGACCACTAAGGAGG + Intergenic
1097994878 12:65877383-65877405 CTGTGCAGAGAGGCCTTAGGAGG + Intronic
1100445379 12:94655301-94655323 CTGCAGAGAGAGGCTCTTGGAGG - Intergenic
1101492399 12:105221917-105221939 CTGCGCACAGAGGCCCTTGGGGG - Intronic
1103746263 12:123126485-123126507 CTGCACACTGACCCCTCTGGTGG + Intronic
1104982814 12:132581782-132581804 CTGAGCAGCCACGCCTTTGGGGG + Exonic
1107388924 13:39942951-39942973 GCTCACAGAGACGCCTTTCGGGG + Intergenic
1109264973 13:60187595-60187617 CTGCACAGACAAGCCTGTGGTGG - Intergenic
1110517074 13:76426250-76426272 CAGCACAGAGTCAGCTTTGGAGG - Intergenic
1110729950 13:78868416-78868438 ATGCACAGAGAAGGCTTTGGTGG - Intergenic
1113814921 13:113163145-113163167 CTGCCCAGGGAGGCCCTTGGGGG - Intronic
1122116930 14:99532375-99532397 ATGCACAGAGAGGCCCCTGGAGG - Intronic
1122695571 14:103550588-103550610 CTCCACAGAGGAGCCTTGGGAGG + Intergenic
1123008080 14:105333944-105333966 CTGCACAGAAACGCCCTTGCTGG + Intronic
1125676006 15:41502910-41502932 CTGCCCAGAGACGCCCTTGCCGG - Intronic
1128402181 15:67294699-67294721 CTGCTCAGAGAAGCCACTGGGGG - Intronic
1129177635 15:73851692-73851714 CTGCACAAAGAGGCCTTTCCAGG + Intergenic
1136540683 16:30926212-30926234 CTGCACAGAGACATCTTGGGGGG - Intronic
1138394236 16:56691874-56691896 CTGGACAGACATCCCTTTGGTGG + Intronic
1145243094 17:21251077-21251099 CTGCACAGCCACTCCCTTGGGGG + Intronic
1145771029 17:27493319-27493341 CAGGACAGAGAGGGCTTTGGAGG + Intronic
1146642313 17:34550578-34550600 CTTCCCAGAGAGGCCTTTGCAGG - Intergenic
1147544400 17:41389312-41389334 TTGGGCAGAGAGGCCTTTGGAGG - Intronic
1147867212 17:43560877-43560899 CTGCACAGAGACGATTCTGTTGG - Intronic
1149461215 17:56831740-56831762 CTGCATAGACACGTGTTTGGTGG - Intronic
1151703707 17:75756129-75756151 CTGGCCTGAGATGCCTTTGGGGG + Intronic
1151874067 17:76856607-76856629 CTGCACAGAGGAGCCGGTGGAGG + Intergenic
1152389053 17:79992106-79992128 CTGCAGAGAGGCGTCTTTGTAGG - Intronic
1152438289 17:80289178-80289200 CTGGAGAGAGGCGCCTCTGGAGG + Intronic
1157329215 18:46691032-46691054 CTGCACAGAGGTGCCCCTGGGGG - Intronic
1161551663 19:4916417-4916439 GGGCACAGGGAGGCCTTTGGAGG - Intronic
1165280475 19:34793012-34793034 CAGCACAGTGACGCCTTTTGGGG + Intergenic
1167594970 19:50422734-50422756 CAGCACAGAGAGGCCATTGTAGG - Intronic
1168464246 19:56589310-56589332 CTCCACAGAGAGGCCTTGGGAGG + Intergenic
1168669659 19:58230948-58230970 CTGCACAGAGAGGACAGTGGTGG + Intronic
926241706 2:11093801-11093823 CTGCACAGGGAATCCTGTGGAGG + Intergenic
926986383 2:18629079-18629101 GTGGATAGAGACTCCTTTGGTGG + Intergenic
930022908 2:47012194-47012216 CTGCACAGAGGCCCCATTGCTGG - Intronic
933176289 2:79177290-79177312 ATTCACAGAGAAGCCCTTGGAGG + Intergenic
934557316 2:95294315-95294337 CTCCACAGAGTTGCGTTTGGAGG + Intergenic
939141483 2:138359347-138359369 CTGCTCAAAGAAGCCTTTGCTGG - Intergenic
945055859 2:205868477-205868499 ATTCACAGAGACAACTTTGGGGG - Intergenic
1169184268 20:3600599-3600621 CTGCCCAGAGAATCCTTAGGAGG + Intronic
1169327066 20:4684986-4685008 CTGGAAAGCGCCGCCTTTGGAGG - Intergenic
1171142076 20:22752022-22752044 CTGGACAGAGGCTCCCTTGGTGG - Intergenic
1176062731 20:63179298-63179320 CAGCCCAGAGCCGGCTTTGGGGG - Intergenic
1178639301 21:34333302-34333324 ATGCAGAGAGAGGGCTTTGGGGG - Intergenic
1178862495 21:36300874-36300896 CTTCACAGAGATGCTTTAGGGGG - Intergenic
1181148032 22:20862616-20862638 CTGCATAGAAAGACCTTTGGGGG - Intronic
1184986406 22:48139169-48139191 CTCCACAGAGAAGAATTTGGAGG + Intergenic
950472995 3:13197977-13197999 CTCCACAGAGAGGCCTCGGGAGG - Intergenic
950539144 3:13599648-13599670 GTGGACTGAGATGCCTTTGGAGG + Intronic
951901683 3:27663716-27663738 CTACAGAGAGATGCATTTGGGGG - Intergenic
961346451 3:126266637-126266659 CTGCACAGAGAGGACGTTGAGGG - Intergenic
961500172 3:127326769-127326791 CTGGACATAGACTCCTTTGAAGG - Intergenic
961817574 3:129559091-129559113 CTGCACAGAGGCGCCTGGGCTGG + Intronic
964808814 3:160640460-160640482 CTGCACAGTGAAGTCTGTGGTGG + Intergenic
965165344 3:165189254-165189276 CTGCCAACAGACGCCTTTGCTGG - Exonic
965603900 3:170481123-170481145 CTACACAGAGACACCAGTGGTGG - Exonic
967730030 3:192898914-192898936 CTGCCCACAGAGGCCTTTGATGG - Intronic
973189152 4:47367421-47367443 CTCCGTAGAGCCGCCTTTGGAGG - Intronic
973852332 4:54973634-54973656 CTTTACAGAGATGCCTTTTGTGG - Intergenic
974146566 4:57955133-57955155 CTTCACAGAGAAGCCTATGAAGG + Intergenic
976686473 4:87820223-87820245 CTGGACAGAGAAGCATGTGGAGG - Intergenic
976995873 4:91432986-91433008 CTGCCCAGAGAGGTATTTGGGGG + Intronic
977065333 4:92305881-92305903 CTGCAGAGAGGTCCCTTTGGGGG + Intronic
981403754 4:144342862-144342884 TTGCAAAGAGATGCTTTTGGGGG - Intergenic
982315277 4:154025071-154025093 CTGAACAGAGGGGACTTTGGTGG + Intergenic
985078145 4:186238415-186238437 CAGCACAGGGACGTCTCTGGGGG - Intronic
987866725 5:23550149-23550171 CTGGACAGACAGGCCTTTTGGGG + Intergenic
1005705442 6:28447106-28447128 GTGCCCAGAGACGACTGTGGTGG + Intergenic
1008381037 6:50840210-50840232 ATACTCAGAGACGGCTTTGGCGG - Exonic
1015778658 6:136840882-136840904 CTGCACAGAGAGGTCTTTCCTGG + Intronic
1018652997 6:166006903-166006925 CTGCACTGAGATTCCTTTGGGGG - Intergenic
1021158887 7:17247047-17247069 CTGAACAGAGAGGCCTTTCTGGG + Intergenic
1021276872 7:18662815-18662837 CAGCACTGAGACCCCATTGGAGG + Intronic
1023604404 7:41915766-41915788 CTGCTCAGAGCTGCCTTTGATGG + Intergenic
1025997325 7:66536259-66536281 CTGGACAGTGACGCCTTTGGTGG - Intergenic
1026990189 7:74580736-74580758 CTGGACAGTGACACCTTTGGTGG - Intronic
1028025176 7:85828224-85828246 CTGCCCAGACAGACCTTTGGAGG - Intergenic
1028532430 7:91852240-91852262 CTGCACTGAGCCCACTTTGGTGG + Intronic
1032886727 7:136148322-136148344 CTGTACAGAGACATTTTTGGAGG - Intergenic
1034528276 7:151679639-151679661 CTGCAGAGAAACCCCTCTGGGGG + Intronic
1035281970 7:157784309-157784331 CTGCACAGTGACGGATTAGGGGG + Intronic
1036360964 8:8076618-8076640 CTGCACCGATACGTCTTTGGAGG + Intergenic
1036890002 8:12590383-12590405 CTGCACCGAGACGTCTTTGGAGG - Intergenic
1037363637 8:18099644-18099666 CTGGACACAGAAGCCTTGGGAGG - Intergenic
1042190222 8:66178335-66178357 CTGCAGAGAGACGTCTCCGGGGG + Exonic
1043507383 8:80915846-80915868 CTCCAAGGAGACTCCTTTGGTGG + Intergenic
1045378443 8:101599445-101599467 CTGCACAGAGACGCCTTTGGGGG - Intronic
1049280479 8:141741606-141741628 CTTCTCAGAGAGGCCTTTGCTGG + Intergenic
1050027996 9:1355539-1355561 CTGAACAGAGTAGCATTTGGTGG - Intergenic
1050754942 9:8990804-8990826 CTGAACAGAGAAGCCTTTCTGGG + Intronic
1050774883 9:9247253-9247275 CTGCACAGACAAGCCTTTCTGGG + Intronic
1057591797 9:96379402-96379424 TTGGACAGAGAGGCCTTTGAAGG - Intronic
1061221194 9:129253251-129253273 CTGGACAAAGGGGCCTTTGGAGG + Intergenic
1061443849 9:130626361-130626383 CAGGAAAGAGACGGCTTTGGAGG + Exonic
1062641449 9:137520809-137520831 CTGAACTGTGACGCGTTTGGAGG - Intronic
1062683961 9:137800415-137800437 CTGCACGGAGCCACCATTGGAGG + Intronic
1186085877 X:5990393-5990415 CTGCACAGAGACACCCTGGGCGG + Intronic
1188062712 X:25620337-25620359 GTGCACAAAGAAGCTTTTGGGGG - Intergenic
1188317627 X:28694053-28694075 CTGCACAGAGTCTCCTTTGGTGG + Intronic
1190093048 X:47456312-47456334 CTGCCCAGAGACGCCTGTACTGG - Exonic
1191676482 X:63796944-63796966 CTGCAGAGTGACACCTTTTGGGG + Intergenic
1192316215 X:70053720-70053742 CTCCACAGCGACGCTGTTGGAGG - Intergenic