ID: 1045378639

View in Genome Browser
Species Human (GRCh38)
Location 8:101600786-101600808
Sequence CAGTGTGACCAGGGAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378632_1045378639 20 Left 1045378632 8:101600743-101600765 CCAATGCTCTGGGGAGGGAGGCC 0: 1
1: 0
2: 1
3: 28
4: 256
Right 1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG No data
1045378635_1045378639 -8 Left 1045378635 8:101600771-101600793 CCAGTAACTGAGCAACAGTGTGA 0: 1
1: 0
2: 0
3: 11
4: 225
Right 1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG No data
1045378634_1045378639 -1 Left 1045378634 8:101600764-101600786 CCTGGAACCAGTAACTGAGCAAC 0: 1
1: 0
2: 1
3: 3
4: 134
Right 1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045378639 Original CRISPR CAGTGTGACCAGGGAGAGGC AGG Intronic
No off target data available for this crispr