ID: 1045378994

View in Genome Browser
Species Human (GRCh38)
Location 8:101604245-101604267
Sequence CGTGGGAATTCCTCATCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378994_1045379002 23 Left 1045378994 8:101604245-101604267 CCCTAAGATGAGGAATTCCCACG 0: 1
1: 0
2: 1
3: 5
4: 53
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378994_1045378999 3 Left 1045378994 8:101604245-101604267 CCCTAAGATGAGGAATTCCCACG 0: 1
1: 0
2: 1
3: 5
4: 53
Right 1045378999 8:101604271-101604293 GACCCTAGTGAGTTATTAAAGGG No data
1045378994_1045378998 2 Left 1045378994 8:101604245-101604267 CCCTAAGATGAGGAATTCCCACG 0: 1
1: 0
2: 1
3: 5
4: 53
Right 1045378998 8:101604270-101604292 AGACCCTAGTGAGTTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045378994 Original CRISPR CGTGGGAATTCCTCATCTTA GGG (reversed) Intronic
900983107 1:6057747-6057769 CCTGGGCATTCCTCAGCTTGTGG + Intronic
902220616 1:14962206-14962228 CCTGGGAAGTCCTCAGCTGAGGG + Intronic
903420082 1:23212577-23212599 CTTGGGAATGCACCATCTTATGG - Intergenic
903714242 1:25351735-25351757 CATGTGAAATACTCATCTTAAGG - Intronic
908153741 1:61330720-61330742 CTTTGAAATTCCTCATTTTAAGG - Intronic
908920154 1:69180798-69180820 TTTAGGAATTCCTCATTTTAAGG + Intergenic
918140657 1:181716949-181716971 TGTGGGGAATCCCCATCTTACGG - Intronic
920760279 1:208777193-208777215 CGTGGGCATTCCTTAGCTTGTGG - Intergenic
1069835589 10:71306027-71306049 CTTGGGAAGTCCTCATCTCCAGG - Intergenic
1074783068 10:116816048-116816070 GGTGCTACTTCCTCATCTTATGG + Intergenic
1077927129 11:6692847-6692869 CCTGTGAATTCCTCATCTCAAGG - Intergenic
1087382706 11:97427237-97427259 CGTGGGCATTCCTGATTTAAAGG - Intergenic
1090334726 11:125954745-125954767 CCTGGGAATTCCTGATTTTACGG + Intergenic
1091092275 11:132782666-132782688 CCTGAGAATTCCTCTTGTTAGGG + Intronic
1093136162 12:15453901-15453923 CGTAGGACTTCCTCCTTTTAAGG + Intronic
1097423593 12:59413297-59413319 CTTGGGACTTCCTCATCCTCTGG + Intergenic
1103857823 12:123986173-123986195 CCTGGGAAAACTTCATCTTAAGG + Intronic
1110770134 13:79333279-79333301 AATAGGAATTCCTGATCTTAGGG - Intronic
1125654085 15:41341522-41341544 CTTTTGCATTCCTCATCTTAGGG + Intronic
1126806142 15:52351293-52351315 AGGAGGAAGTCCTCATCTTAAGG - Exonic
1137509980 16:49090584-49090606 GGTGGGAGTTCCTCATCACAGGG + Intergenic
1140835860 16:78793001-78793023 CAAGGAAATTCCGCATCTTAAGG - Intronic
1144046164 17:11456527-11456549 TGTCTGAATTCATCATCTTATGG - Intronic
1149606063 17:57926007-57926029 ACTGGGAAGTCCTCATCCTAGGG + Intronic
1160956245 19:1693345-1693367 CGTCCGCATCCCTCATCTTAGGG + Intergenic
1163306431 19:16482515-16482537 AGTCGGTATTCTTCATCTTACGG + Exonic
1165764897 19:38344155-38344177 CGGGGGAATTCCTCACCCCAGGG + Intronic
1168264160 19:55212452-55212474 CGTGGAAATTTCTGTTCTTAAGG - Intergenic
926204359 2:10824647-10824669 CGTGGGTTTTCCTCATCTTGTGG - Intronic
940864099 2:158799884-158799906 CATGGGAATTCCTCATCCTTAGG - Intronic
941453458 2:165687873-165687895 CGGGGGTGTTCCTCATCTTCTGG - Exonic
1171117790 20:22541300-22541322 CGGGGGACTTCTTCCTCTTAAGG + Intergenic
1174959882 20:55144054-55144076 TGTTGGATTTCCTCATCTTGAGG + Intergenic
1185306792 22:50122617-50122639 CTTGGAAGTTCCTGATCTTATGG + Intronic
949103238 3:171638-171660 CCAGGGAATTCCTCATTTGATGG - Intergenic
951624432 3:24644525-24644547 CATGAGAATTCCTCATATTTGGG - Intergenic
953024091 3:39134884-39134906 CTTGGGAAGTCCTCACCTTCTGG + Intronic
954827919 3:53391351-53391373 CGGGGGATTTCCTTTTCTTAGGG + Intergenic
956507035 3:69952525-69952547 TGTGTGAATTTCTCATCTCATGG + Intronic
962313715 3:134344750-134344772 GGAGGGACTTCCTCATCTGAAGG + Intergenic
964574452 3:158149398-158149420 GATGGGAATACCTGATCTTAAGG - Intronic
966865421 3:184256401-184256423 CCTGGGAAGGCCTCATGTTAGGG - Intronic
981436078 4:144723609-144723631 TGTGGGAATTTATCAACTTAGGG - Intronic
982207092 4:153004897-153004919 CGTGGGAATTCCTCGTGTTATGG + Intergenic
988933963 5:36064629-36064651 CATGGGAGTTCCTCATCCTGAGG + Intronic
990348090 5:54888738-54888760 CAGGTGAATTCCTCATCTAAAGG + Intergenic
994998809 5:107100938-107100960 CAAGGGAATTCTTCATCTTTTGG - Intergenic
1000119094 5:158179702-158179724 CATGGGAATCCCTCACCTTCTGG + Intergenic
1003337050 6:5183687-5183709 AGTGGTAATTTCTCATCTTTCGG + Intronic
1008597410 6:53056529-53056551 TGGGGGATTTCCTCATCTTCAGG - Intronic
1012418022 6:99031162-99031184 AGTGAGAATTGCTCATCTTTGGG - Intergenic
1013883299 6:114931719-114931741 GGTTGGAATTCCTCTTCTTTAGG + Intergenic
1017823353 6:158064454-158064476 TGTGGGAACTCCTCATCCTCTGG + Intronic
1028484894 7:91347113-91347135 AGTGGGAATTGCTCTTTTTAAGG - Intergenic
1029234396 7:99101589-99101611 GGTGGGAATTCCACATCTAAAGG + Intronic
1032559618 7:132874982-132875004 TGTTGGAATTCCTAATCTGAGGG - Intronic
1033053225 7:138025776-138025798 TGGGGGAATTCCTCTCCTTAAGG - Intronic
1045378994 8:101604245-101604267 CGTGGGAATTCCTCATCTTAGGG - Intronic
1197851639 X:130868247-130868269 ATTGGGAATTTCTCATCTTTTGG - Intronic
1198660696 X:138965058-138965080 CCTGGGAATTCATCAGGTTAAGG - Intronic