ID: 1045378995

View in Genome Browser
Species Human (GRCh38)
Location 8:101604246-101604268
Sequence GCGTGGGAATTCCTCATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378995_1045378999 2 Left 1045378995 8:101604246-101604268 CCTAAGATGAGGAATTCCCACGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1045378999 8:101604271-101604293 GACCCTAGTGAGTTATTAAAGGG No data
1045378995_1045379002 22 Left 1045378995 8:101604246-101604268 CCTAAGATGAGGAATTCCCACGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378995_1045378998 1 Left 1045378995 8:101604246-101604268 CCTAAGATGAGGAATTCCCACGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1045378998 8:101604270-101604292 AGACCCTAGTGAGTTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045378995 Original CRISPR GCGTGGGAATTCCTCATCTT AGG (reversed) Intronic
902220614 1:14962205-14962227 GCCTGGGAAGTCCTCAGCTGAGG + Intronic
922797277 1:228346588-228346610 GCTTGGGAAGCCCTCATTTTGGG + Intronic
1064885442 10:20106396-20106418 GCAGGGGAATCCCTCATTTTTGG + Intronic
1065819026 10:29508265-29508287 GCGTGGGTAATCCTGATCCTGGG - Intronic
1065953794 10:30675657-30675679 GCGTGGGTAATCCTGATCCTGGG + Intergenic
1066525532 10:36274960-36274982 GAGTGGGATCTCCTGATCTTTGG - Intergenic
1067434021 10:46264777-46264799 GCCTGGGAGCTCCTCATCTGAGG - Intergenic
1074952813 10:118356272-118356294 GAGTGGGAATGACTCAGCTTGGG + Intergenic
1076764814 10:132627292-132627314 GGCTGGGAATACCTCACCTTGGG + Intronic
1081679720 11:44993660-44993682 GCATGAGAATTCCTGCTCTTAGG + Intergenic
1084667283 11:70583198-70583220 GCCTGGGAATCCCCCATCTTTGG - Intronic
1087233042 11:95687421-95687443 GGGTGGGAATTACTCATTTAGGG - Intergenic
1096115717 12:49053957-49053979 GGGTGAGAAGTCCTGATCTTTGG - Exonic
1096149181 12:49297900-49297922 GCGTGGGAATCTCTCCTCTTAGG - Intronic
1098285343 12:68901388-68901410 GACTGTGAATTCCTCACCTTGGG - Intronic
1108463760 13:50694051-50694073 CCTTGGGAATTCCTCCTCCTGGG + Intronic
1111630067 13:90839228-90839250 ACCTTGGAATTCCTCATCTGTGG + Intergenic
1113722801 13:112573562-112573584 GGGTGGGAGTTCCTCAGATTGGG - Intronic
1130386195 15:83414491-83414513 GCATGGGAATACCTCATCCTAGG + Intergenic
1135500240 16:22989982-22990004 GCTGGGGAAATCCTCAGCTTTGG - Intergenic
1139337931 16:66246058-66246080 CCCAGGGAATTCCCCATCTTTGG - Intergenic
1143971475 17:10799139-10799161 GCATGGGACCTCCTCATCTCTGG + Intergenic
1152471404 17:80491950-80491972 GCGTGGGGTTTCCTCTGCTTTGG - Intergenic
1156252791 18:35367327-35367349 GTGTGGTAATTCCACATATTTGG + Exonic
1158441507 18:57478757-57478779 GTGTGAGAAATCCTCATCTTTGG - Exonic
1160956244 19:1693344-1693366 GCGTCCGCATCCCTCATCTTAGG + Intergenic
1161457280 19:4375686-4375708 GCATTGTAATTTCTCATCTTGGG + Intronic
1163429777 19:17260284-17260306 GAGAGGGAAGCCCTCATCTTAGG - Intronic
1166092886 19:40521708-40521730 GCTTGGGAAATCCTGATCTAGGG + Intronic
1168451722 19:56471489-56471511 GCCTGGGAATTCTTAAACTTTGG + Intronic
925859460 2:8160772-8160794 ACTTGGGAATTCATCATGTTAGG - Intergenic
930170222 2:48244188-48244210 GTGGGGGAATTTCTCTTCTTTGG - Intergenic
936580563 2:113696892-113696914 GTGTGGGAATGCCCCATCCTTGG - Intergenic
938079809 2:128363888-128363910 GTGAGGGATTTCCTCCTCTTCGG + Intergenic
940593299 2:155757286-155757308 GCTTGGCAATTCCTCATGTAGGG + Intergenic
946674308 2:222142268-222142290 TTGTGGAAATTACTCATCTTTGG - Intergenic
948346303 2:237301510-237301532 GCAAGTGAATTACTCATCTTAGG + Intergenic
1170085456 20:12526467-12526489 GAGCCAGAATTCCTCATCTTTGG + Intergenic
1170774423 20:19363273-19363295 GTGTGGGAACTCCACAGCTTTGG - Intronic
1175628462 20:60510388-60510410 GAGTACCAATTCCTCATCTTAGG - Intergenic
1177057709 21:16329143-16329165 GCCTGGGAACTTCACATCTTTGG + Intergenic
1179631936 21:42684116-42684138 GCGTGGGAATCCCTCAGCCGGGG + Intronic
1184206008 22:43003795-43003817 GCTTAGGAGTGCCTCATCTTCGG - Intronic
1184319748 22:43731631-43731653 GCATGGTAATTCCTGTTCTTTGG - Intronic
951624433 3:24644526-24644548 GCATGAGAATTCCTCATATTTGG - Intergenic
963905069 3:150766662-150766684 GCATGGAAATTCCTCATCAGGGG + Intergenic
971234284 4:24827365-24827387 GCTTGGAAATTCAGCATCTTGGG - Intronic
971820113 4:31541178-31541200 GCATAGGAATTTCTAATCTTTGG + Intergenic
972262129 4:37419753-37419775 TTATGGGAATTCATCATCTTGGG + Intronic
997540622 5:134658839-134658861 GTGTGGAAATTTCTCATCTCAGG + Intronic
999967391 5:156824131-156824153 GCATAGGAATTCCTTGTCTTTGG - Intergenic
1006834869 6:36991872-36991894 CAGGGGGAATGCCTCATCTTTGG + Intergenic
1010279378 6:74006364-74006386 GAGTGGGAGTACCTCATATTTGG + Intergenic
1012418023 6:99031163-99031185 TAGTGAGAATTGCTCATCTTTGG - Intergenic
1013517471 6:110901442-110901464 GTTTAAGAATTCCTCATCTTTGG + Intergenic
1029726972 7:102412944-102412966 GTGTGGGAATACATCATCTGGGG - Intronic
1031997413 7:128241636-128241658 GGGTGGGACATCCTGATCTTTGG - Intronic
1037287634 8:17318226-17318248 GCATGATAATTCCTTATCTTGGG - Intronic
1039643861 8:39257316-39257338 ACTTGGGAATTCCTCTTCCTTGG - Exonic
1045378995 8:101604246-101604268 GCGTGGGAATTCCTCATCTTAGG - Intronic
1049015195 8:139915015-139915037 GGGTGGGAAATCATTATCTTTGG + Intronic
1054328519 9:63729941-63729963 CCGTGGAGAATCCTCATCTTGGG - Intergenic
1058725548 9:107800049-107800071 GCCTGGGAATTCCAGATCCTGGG + Intergenic
1186416444 X:9386943-9386965 GCTTGGGAATCCCTCTTCATTGG + Intergenic
1193437295 X:81491286-81491308 GCTTTGCCATTCCTCATCTTTGG + Intergenic