ID: 1045378996

View in Genome Browser
Species Human (GRCh38)
Location 8:101604262-101604284
Sequence AACTCACTAGGGTCTTGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378996_1045379002 6 Left 1045378996 8:101604262-101604284 CCCACGCAAGACCCTAGTGAGTT 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045378996 Original CRISPR AACTCACTAGGGTCTTGCGT GGG (reversed) Intronic
903168712 1:21538794-21538816 AACTCACTTGGGGCTTGCAGTGG - Intronic
904344823 1:29860922-29860944 ACCTTACTTGGGTCTTGCTTGGG + Intergenic
908965919 1:69762704-69762726 AACTCACTAGGATCCTAAGTAGG + Intronic
909471578 1:76034745-76034767 CACACACTAGGGTCTTTTGTGGG - Intergenic
916936115 1:169629879-169629901 AACTCACAAGGGTGTTGGGAGGG + Intronic
923129615 1:231064165-231064187 AACTCACTAGGTTTTTCTGTAGG - Intergenic
1074785929 10:116839956-116839978 AATTCACTAGGGGCATGCCTTGG - Intergenic
1078034696 11:7791024-7791046 CACTCACTAGGGCCTGTCGTGGG + Intergenic
1088510268 11:110566404-110566426 AAATCACCAGCTTCTTGCGTGGG + Intergenic
1089151339 11:116366733-116366755 AAGTCAGGAGGGTCTTGAGTTGG - Intergenic
1103459978 12:121096053-121096075 GACTCCCCAGGCTCTTGCGTGGG - Intergenic
1109501994 13:63249913-63249935 AACTGCCGAGGGTCTTGCCTGGG + Intergenic
1118642303 14:67804094-67804116 AACTCACCAGGCTCTTGCTGGGG + Exonic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1130434220 15:83881271-83881293 AACTTTCTAGGGTCCTGGGTTGG + Intronic
1140578400 16:76199789-76199811 GACTCACTAGGGTCCTTCATGGG + Intergenic
939916859 2:148055822-148055844 AACTCACTATTGTGTTGCATTGG + Intronic
943678687 2:190744692-190744714 AACTCACTAAAGTTTTGCCTTGG + Intergenic
945946118 2:215997574-215997596 ACCTCACTAGAGTCTAGCATGGG + Intronic
1176709205 21:10135222-10135244 AGCCCACTGGGGTCCTGCGTAGG + Intergenic
1179986357 21:44922820-44922842 AAATCAACAAGGTCTTGCGTTGG + Intronic
1182666748 22:31965677-31965699 AACTCACCTGGCTGTTGCGTGGG + Intergenic
960016840 3:112900543-112900565 AACTCACCAGTCTCTTGCCTTGG - Intergenic
970353240 4:15227275-15227297 CACTCACGTGGGTCTTGTGTGGG + Intergenic
973822609 4:54676238-54676260 AACTCAGCAGGTTCTTGGGTGGG - Intronic
976264047 4:83173554-83173576 GACTCCCTGGGGTCTTGCGCTGG + Intergenic
978776906 4:112514617-112514639 AACCCACTAAGGCCTGGCGTGGG + Exonic
985469188 5:27506-27528 AACTCACAAGGGTATTGACTGGG - Intergenic
994056579 5:95423344-95423366 AATAGACTAGGGGCTTGCGTGGG + Intronic
1001168975 5:169399348-169399370 AAATCACTTGTGTCTTGGGTAGG - Intergenic
1001692164 5:173641333-173641355 AACTCACCAGGGTCCTGAGAAGG - Intergenic
1014236873 6:118967930-118967952 ACCTCTCTAGGGTTTTGGGTGGG - Intronic
1022376566 7:29817915-29817937 AACACACTATAGTCTTGGGTAGG - Intronic
1027946743 7:84756827-84756849 AACTCACAAGAGACTTACGTGGG + Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1040574097 8:48635759-48635781 AATTCACGAGTGTCTTGGGTAGG + Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1049500900 8:142964954-142964976 AAATCACTAGGGTATTGATTGGG + Intergenic
1056255947 9:84799889-84799911 AATTAATTAGGGACTTGCGTTGG - Intronic
1202793965 9_KI270719v1_random:104192-104214 AGCCCACTGGGGTCCTGCGTAGG + Intergenic
1203791147 EBV:152281-152303 GACTCACTTGGGTATGGCGTTGG - Intergenic
1186008687 X:5104765-5104787 AATTAACTAGTGTCTTGCTTTGG - Intergenic
1186760869 X:12720653-12720675 AAATCATTAGGGTCTTGATTTGG - Exonic
1188342340 X:29019499-29019521 AACTCCCAAGGTTCTTGCTTTGG + Intronic