ID: 1045378997

View in Genome Browser
Species Human (GRCh38)
Location 8:101604263-101604285
Sequence TAACTCACTAGGGTCTTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378997_1045379002 5 Left 1045378997 8:101604263-101604285 CCACGCAAGACCCTAGTGAGTTA 0: 1
1: 0
2: 0
3: 0
4: 68
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045378997 Original CRISPR TAACTCACTAGGGTCTTGCG TGG (reversed) Intronic
910553002 1:88498087-88498109 TAACACACTGTGGTCTTGCCTGG - Intergenic
915710181 1:157890004-157890026 TAACTCACTATGGTTTTGATTGG - Intronic
916936114 1:169629878-169629900 CAACTCACAAGGGTGTTGGGAGG + Intronic
921178491 1:212613542-212613564 TAACTCACTGGGTTCTCGTGAGG + Intronic
921269821 1:213457446-213457468 TAACTCATTAGGGACTTTCCGGG + Intergenic
1074860643 10:117507505-117507527 TAACTCACAAGGTTGTTGTGAGG + Intergenic
1078034695 11:7791023-7791045 TCACTCACTAGGGCCTGTCGTGG + Intergenic
1092926051 12:13273410-13273432 TATCTCACAAGGGTGTTGTGAGG + Intergenic
1103459979 12:121096054-121096076 TGACTCCCCAGGCTCTTGCGTGG - Intergenic
1112719443 13:102226306-102226328 TATCTCACTAGAGTGTTGTGAGG + Intronic
1118642302 14:67804093-67804115 CAACTCACCAGGCTCTTGCTGGG + Exonic
1118712987 14:68538028-68538050 TAACACACTTAGGTCTTGCTAGG + Intronic
1118916817 14:70114720-70114742 AAACTCATTTGGGTCTTGCTTGG - Intronic
1120644517 14:87057782-87057804 TAACTCACTAGGCATTTGTGGGG - Intergenic
1121114440 14:91333743-91333765 TTACTCCCTAGGGTCTAGGGTGG + Intronic
1123035367 14:105469725-105469747 TAACTCACTGGGGTGGTGGGGGG + Intronic
1126956335 15:53936734-53936756 AAAGTCACTAGGGTCTGGAGTGG + Intergenic
1129318771 15:74762424-74762446 TCTCTCACTGGGGTCTTGCCAGG + Intergenic
1130401635 15:83560615-83560637 TAACTCACTGGGGTTTTTGGAGG - Intronic
1140622296 16:76749895-76749917 TAACTCAATAGGGACTTCAGCGG + Intergenic
1141316556 16:82967867-82967889 TAACTAACAAGGGTCTTGGAAGG + Intronic
1141477104 16:84281422-84281444 AAACTCATGAGGGTCTTGAGGGG - Intergenic
1148005361 17:44423570-44423592 TAACTTACTAGGTTTTTGGGGGG - Intronic
1150136099 17:62696209-62696231 AGAGTCACTAGGGTCTTGGGGGG - Intergenic
1154183147 18:12155327-12155349 TAAATCACTGGGGACTTGCATGG + Intergenic
1163515009 19:17757462-17757484 CAACTCCCAAGGGTCTTGCTGGG - Intronic
931031705 2:58182976-58182998 TATCTCACTCGGATCTTGTGAGG - Intronic
933967526 2:87442276-87442298 AAACTCACTTGGGTCTAGAGGGG + Intergenic
934649679 2:96083745-96083767 TCTCTCCCTAGGGTCTTGCAGGG - Intergenic
936326269 2:111508220-111508242 AAACTCACTTGGGTCTAGAGGGG - Intergenic
1169476299 20:5934034-5934056 TAACTCCCTAGGGTGTTTGGAGG - Intergenic
1173010545 20:39177771-39177793 TAACTCACTGTGTTCTTGGGAGG + Intergenic
1173863912 20:46302151-46302173 TTCCTCCCTAGGGTCTAGCGTGG - Intronic
1182259012 22:29059461-29059483 TAAATAATTAGGATCTTGCGTGG - Intronic
949543500 3:5052869-5052891 TAGCTCAGCAGGGTTTTGCGTGG + Intergenic
959661831 3:108877554-108877576 GAACTCTCAAGGGTCTTGTGGGG + Intergenic
961920156 3:130417095-130417117 TCACACACTAGGGTCTGTCGGGG - Intronic
969100208 4:4762943-4762965 TTACTCTCTAGGGTCATGTGGGG + Intergenic
969629353 4:8326786-8326808 TAACTTGCTAGGGTCTTGATTGG + Intergenic
971214817 4:24653065-24653087 TTACTCACTAGGAGCTTTCGTGG - Intergenic
976439724 4:85059224-85059246 TAGCACACTGGGGTCTTGTGAGG + Intergenic
991534380 5:67650609-67650631 TAACTCTTTAGGGTCTAGAGTGG + Intergenic
994056578 5:95423343-95423365 TAATAGACTAGGGGCTTGCGTGG + Intronic
997860578 5:137411717-137411739 TATCTCACCAGGGCCTTGTGAGG + Intronic
998295034 5:140961178-140961200 AACCTCACTAGGGTCCTGTGAGG - Intronic
1001373956 5:171236730-171236752 TAATTCACAAGGCTCTTACGTGG - Intronic
1002589848 5:180282943-180282965 CAAGTCACTAGGGACTTGCTGGG + Intronic
1005695688 6:28350566-28350588 TAACTCACTGGGTTGTTGTGAGG + Intronic
1014236874 6:118967931-118967953 TACCTCTCTAGGGTTTTGGGTGG - Intronic
1024131024 7:46353504-46353526 TAACTCAGTTGGGTCTTGAATGG + Intergenic
1027548643 7:79562604-79562626 TCACACACCAGGGTCTTTCGCGG - Intergenic
1029106231 7:98178818-98178840 TAACTCACAAGGCTGTTGCAAGG - Intronic
1033152987 7:138932769-138932791 TGACTCCGTAGGGTCTTGAGTGG - Intronic
1036578337 8:10049676-10049698 TAAGCCACTAGGGTTTTGAGTGG - Intergenic
1038300320 8:26339954-26339976 TACCTCACTGGGGTGTTGTGAGG - Intronic
1038926725 8:32148769-32148791 TAACTTACTGGGGTGTTGTGAGG - Intronic
1040895246 8:52361343-52361365 TGAATCACTAGAGTCTTGAGGGG + Intronic
1045378997 8:101604263-101604285 TAACTCACTAGGGTCTTGCGTGG - Intronic
1054787553 9:69223253-69223275 TAACACACAAGGTTCTTGTGAGG - Intronic
1059698033 9:116747481-116747503 TAACTCACAAGGTTGTTGAGAGG - Intronic
1060867073 9:127009015-127009037 TAAGCCTCTAGGATCTTGCGTGG - Intronic
1061123604 9:128659521-128659543 AAACTCACTAAGGTCTGGTGTGG + Intergenic
1186178480 X:6949902-6949924 TAACTCACATGGCTCTTGGGAGG + Intergenic
1189231081 X:39452968-39452990 TACCTCACTAGGTTATTGTGGGG - Intergenic
1191828873 X:65393460-65393482 TTACACACTAGGGCCTTTCGGGG - Intronic
1193959803 X:87911456-87911478 AAAATCACTCGGGTCTTGCTGGG + Intergenic
1196596756 X:117554772-117554794 TCACACACTAGGGTCTGTCGAGG + Intergenic
1196719508 X:118840117-118840139 TAACTGACTAGTTTCTTGCTTGG + Intergenic
1197117126 X:122846549-122846571 TAACTCATAAGGATCTTGTGAGG + Intergenic