ID: 1045379000

View in Genome Browser
Species Human (GRCh38)
Location 8:101604273-101604295
Sequence AGCCCTTTAATAACTCACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045379000_1045379002 -5 Left 1045379000 8:101604273-101604295 CCCTAGTGAGTTATTAAAGGGCT 0: 1
1: 0
2: 1
3: 16
4: 121
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045379000 Original CRISPR AGCCCTTTAATAACTCACTA GGG (reversed) Intronic
903347779 1:22698316-22698338 AGCCTTTTATTAGCTCACTGAGG - Intergenic
910203161 1:84721239-84721261 AGCCATAAAATACCTCACTATGG + Intergenic
910381835 1:86634658-86634680 AGCCTTTTAATAATTCACTGGGG - Intergenic
910494923 1:87816141-87816163 AGTCCTGTATAAACTCACTAGGG + Intergenic
911741173 1:101387980-101388002 AGCCATTCAACAACTCTCTAGGG + Intergenic
912852359 1:113138068-113138090 AGCCCTAAAATAGCTCACTGGGG - Intergenic
917022325 1:170602567-170602589 AGCCATTTAACAAGTCTCTAGGG + Intergenic
922125654 1:222719605-222719627 TGACCTTTAATAACACACAAAGG + Intronic
924040420 1:239979153-239979175 AGCCATTTAATAAGGCTCTAGGG - Intergenic
1063857923 10:10275555-10275577 AGTCCTTTAATTCCTCTCTATGG - Intergenic
1065900817 10:30206397-30206419 AGGCCTTGAATATCCCACTAAGG + Intergenic
1067488609 10:46676449-46676471 ATCCCTTTAATATATCCCTAAGG + Intergenic
1067606060 10:47663928-47663950 ATCCCTTTAATATATCCCTAAGG - Intergenic
1068900097 10:62258793-62258815 AGCCCTGTAATAGCTCACCATGG + Intronic
1071430259 10:85601561-85601583 AGCCCTCAATTACCTCACTATGG + Exonic
1071671802 10:87615955-87615977 AGCCCTCTAATTACTCAAGAAGG + Intergenic
1073839342 10:107480529-107480551 AGCCATTTAATAACTACCTCTGG - Intergenic
1075217229 10:120546454-120546476 ATTCCTTTAATAACTCGCTGGGG + Intronic
1075554269 10:123418812-123418834 AGCCCTTTGATGACCCACAATGG - Intergenic
1078656055 11:13240368-13240390 AGCCTTTGAATAACACATTATGG - Intergenic
1079456574 11:20641707-20641729 AGCTCATTAATAACTCACACAGG + Intronic
1079483907 11:20913741-20913763 AGGCCTTAAATAAATCCCTAAGG - Intronic
1080911638 11:36606156-36606178 AGTCCTTTAAAAAGTCAATAAGG + Intronic
1081191004 11:40103066-40103088 AGGCCTTTAATAATTAAGTAAGG + Intergenic
1086947376 11:92856457-92856479 AGTTCTTAAATAACTCACTTGGG + Intronic
1092662757 12:10756252-10756274 AGCCCTTCAACAACTCTCTAGGG + Intergenic
1093315678 12:17647123-17647145 AGGCCTTTAATGCCCCACTATGG - Intergenic
1097498855 12:60377444-60377466 AGCCATTCAACAACTCTCTAGGG - Intergenic
1098780026 12:74675565-74675587 AGCCTTTTAATCTCTCATTATGG - Intergenic
1099466176 12:82990756-82990778 AGCCCTTAAATAACTTATAAAGG - Intronic
1100251627 12:92830781-92830803 AGCCCATTAATAACTCTTTATGG - Intronic
1106694443 13:32156870-32156892 AGGACTTTAATAACTCCATATGG - Intronic
1106739659 13:32626216-32626238 AGCACTTCAACAACTCAGTAGGG - Intronic
1108183871 13:47869072-47869094 AGCTTTTTTATAACTCACCAAGG - Intergenic
1111143742 13:84155243-84155265 AGCCATTTAACAAGTCTCTAGGG - Intergenic
1111864517 13:93751958-93751980 TGCCCTTTAATAATTCTCTCAGG + Intronic
1113668367 13:112157111-112157133 AGCCCTCTAATCACTTACTTAGG - Intergenic
1113883490 13:113643609-113643631 AGTCCTTTAAAATCTCACTTTGG + Intergenic
1115679278 14:35718281-35718303 ATTCCTTTAAGTACTCACTATGG - Intronic
1119982528 14:79098080-79098102 AGCCCTTTGAAAAGTCACTTGGG + Intronic
1120845560 14:89122021-89122043 TGCCCTGTAATAACTCATTCTGG - Intergenic
1125204749 15:37140711-37140733 AGACCTGTAATCAGTCACTATGG + Intergenic
1130565364 15:84989517-84989539 AGTCTTTTAACACCTCACTAGGG - Intronic
1131768022 15:95701395-95701417 AGCCATTTAACAAGTCTCTAGGG + Intergenic
1133942073 16:10317631-10317653 AGCCCAATCATAGCTCACTATGG - Intergenic
1138993321 16:62418006-62418028 AGCCCTTTTATGACACACTCTGG + Intergenic
1143877667 17:10004400-10004422 AACCCTTTAAAAGCTCACTCTGG + Intronic
1148623362 17:49051304-49051326 AACCCTTTAGGAACTCTCTATGG + Exonic
1153348444 18:4052981-4053003 AGCCATTCAATAAGTCTCTAGGG + Intronic
1153370740 18:4312883-4312905 AGTCATTTATTAACTCTCTATGG + Intronic
1154400531 18:14032745-14032767 AAACCTTTACTACCTCACTATGG - Intergenic
1155378222 18:25185828-25185850 ATCCCTGTAATATTTCACTAAGG - Intronic
1164273443 19:23694770-23694792 AGCTTTTTAATAAATCTCTAGGG + Intergenic
1167927883 19:52836453-52836475 AGCCATTTAAGAACTGACTGGGG + Intronic
926591922 2:14749599-14749621 AGCTCTTTCAGAACTCACTATGG + Intergenic
928227627 2:29466598-29466620 AGCCCTTTAATTCATCACAATGG - Intronic
929104111 2:38347168-38347190 AGCCCTTAAATACCTTACCATGG + Intronic
929748360 2:44683391-44683413 AGTCCCCTAATACCTCACTATGG - Intronic
932734580 2:74245813-74245835 AGCCCCTTAATACATTACTACGG - Intronic
934144063 2:89074617-89074639 AGCCATTTAACAACTCTTTAGGG - Intergenic
934225181 2:90125935-90125957 AGCCATTTAACAACTCTTTAGGG + Intergenic
938378065 2:130821722-130821744 AGGCCTTTAATAACCCATTCTGG - Intergenic
941343369 2:164336184-164336206 TGCCCTTTAATGACTCTCTTAGG - Intergenic
941950336 2:171149272-171149294 GGCACTTTAACAAGTCACTATGG - Intronic
942118278 2:172750057-172750079 AGCCATTCAACAAGTCACTAGGG + Intronic
946469605 2:219946323-219946345 AGCCCTTTAAAAACTAAACAAGG + Intergenic
948118877 2:235514289-235514311 AGCCTTTAAATAGCTCACTAGGG + Intronic
1169826043 20:9769871-9769893 AGCTCTTTAAAAACTAAATATGG + Intronic
1169935279 20:10877224-10877246 AGGCTTTTAATAAAACACTATGG + Intergenic
1170091940 20:12598881-12598903 AGCCCTTGACAAACTCACTTTGG - Intergenic
1170091945 20:12598906-12598928 AGCCCTTGACAAACTCACTGAGG - Intergenic
1170785437 20:19463321-19463343 CGCCCTTGAGTACCTCACTAGGG - Intronic
1174509017 20:51037046-51037068 AACTCTTTAATAAATCCCTAGGG - Intergenic
1175302683 20:57953997-57954019 TTCCCTTTCATAACTCACAAAGG + Intergenic
1176896065 21:14380319-14380341 AGGTCTTTTATAGCTCACTAAGG + Intronic
1179956591 21:44743688-44743710 TGGCCTTTAATAACTAAGTAAGG + Intergenic
949186085 3:1193118-1193140 AGGACTTTAATAGCTCAATATGG - Intronic
949832651 3:8232545-8232567 AGCCCTTAAATAGCTCAAGATGG + Intergenic
951924991 3:27899516-27899538 AGCCCTTTAATTTCTCCTTAAGG - Intergenic
965337455 3:167444498-167444520 AGCCATTTAATAGTTCACTATGG + Intronic
966992434 3:185247411-185247433 AGCCATTTAATAACTGGTTAAGG + Intronic
969994273 4:11295487-11295509 AGAGGTTCAATAACTCACTAAGG - Intergenic
970357320 4:15268867-15268889 AGCCATTTAACAAATCTCTAGGG - Intergenic
972360488 4:38321767-38321789 CACCCTTGAATAACTCACTCTGG + Intergenic
972582300 4:40405731-40405753 AGCCCTTCAACAAGTCTCTAAGG - Intergenic
974389559 4:61248245-61248267 AGCATTTCAATAACTCACCATGG - Intronic
974897523 4:67957328-67957350 AGCCATTTAACAAGTCTCTAGGG - Intronic
975942052 4:79659799-79659821 AGCCATTCAATAAGTCTCTAGGG - Intergenic
976097300 4:81522829-81522851 TGCCCTTTATTAACCCACTATGG + Intronic
977393846 4:96447980-96448002 AGCCATTTAACAAGTCTCTAAGG - Intergenic
977395844 4:96469480-96469502 AGCCATTCAATAAGTCTCTAGGG + Intergenic
978213245 4:106163259-106163281 AGCCATTCAATAAGTCTCTAGGG + Intronic
978503920 4:109436373-109436395 AGCCTTTTAATATATCTCTATGG + Intronic
978559818 4:110021466-110021488 AGGCCTATAATACCTCTCTAAGG - Intergenic
978892236 4:113844054-113844076 CGTCCTTTAACAATTCACTATGG + Intergenic
979764802 4:124451613-124451635 GGCCACTTAATAAATCACTATGG - Intergenic
980321763 4:131288920-131288942 TGCCGTGTAATAACTAACTAGGG - Intergenic
984835155 4:184012560-184012582 AGCCCTTTAATAAATCACAAAGG - Intronic
989252239 5:39330932-39330954 AGCCCTGTAATAACTGAATAAGG + Intronic
1000147130 5:158464515-158464537 AGCCCTCTGATTACTCACTTGGG + Intergenic
1000567387 5:162866879-162866901 AGCACTTTAAAAACACACTTAGG - Intergenic
1000961366 5:167605167-167605189 AGCCCTTTAATGACTCCCCATGG - Intronic
1007889202 6:45270820-45270842 AGCCATTTAACAAGTCTCTAGGG - Intronic
1008008251 6:46435457-46435479 AGCCCTTTAAAATCTGAATATGG - Intronic
1009715809 6:67393945-67393967 AGCCATTCAATAAGTCTCTAAGG - Intergenic
1012437599 6:99230981-99231003 AGCCCCCAAATAACTAACTAAGG + Intergenic
1012749845 6:103144776-103144798 AGCCATTCAATAAGTCTCTAAGG + Intergenic
1012756575 6:103239756-103239778 AGCCATTTAACAAGTCTCTAGGG - Intergenic
1015045270 6:128768937-128768959 AGCCATTCAATAAGTCTCTAGGG + Intergenic
1016108086 6:140187840-140187862 AGCCATTCAACAACTCTCTAGGG - Intergenic
1019601722 7:1887072-1887094 AGCCCTTGAAACACTCACTCAGG + Intronic
1022611179 7:31875028-31875050 ATCCCTTTAATATCCCACTAGGG + Intronic
1027453975 7:78364189-78364211 ACCCTTTTAAAATCTCACTAAGG - Intronic
1027986442 7:85297113-85297135 AGCCCTTTAAAAATTTACTTTGG + Intergenic
1029690052 7:102175338-102175360 AGCCCTTTAATCAGTGTCTATGG + Intronic
1036426010 8:8645825-8645847 AGACCTTTGAGATCTCACTATGG - Intergenic
1038822816 8:30968458-30968480 ATCCCCTTAATAACCCTCTAAGG - Intergenic
1038881777 8:31622223-31622245 AGCACATTAAAAAGTCACTAGGG + Intergenic
1038915820 8:32021382-32021404 AGCCCTGTAACAACCCACTCTGG + Intronic
1039236568 8:35508748-35508770 AGCCCTTTAATTACACACACTGG + Intronic
1040526634 8:48231402-48231424 TGGCCTTTAATAACTGAGTAAGG + Intergenic
1041222862 8:55669472-55669494 AGCCATTTAACAAGTCTCTAGGG - Intergenic
1042650074 8:71030753-71030775 AACCCTTTAAAAAGTCACTTGGG - Intergenic
1044087294 8:87956534-87956556 AGCCATTTAACAAGTCTCTAGGG + Intergenic
1045379000 8:101604273-101604295 AGCCCTTTAATAACTCACTAGGG - Intronic
1045588270 8:103563535-103563557 AGCCATTCAACAAGTCACTAGGG + Intronic
1045995747 8:108359565-108359587 AGCCATTCAATAAGTCTCTAGGG + Intronic
1048033111 8:130651609-130651631 AGCCCTGTAATAACTTCCTAGGG + Intergenic
1051304189 9:15690778-15690800 AGCGCTTTTATAAACCACTAAGG + Intronic
1054997004 9:71403214-71403236 AGTCCTTTAAGAACTGTCTATGG + Intronic
1055199368 9:73640514-73640536 AATCCTTTGATCACTCACTAAGG - Intergenic
1056595070 9:88001292-88001314 AGCCCTTTAACAAGTCTCTAGGG - Intergenic
1188607682 X:32052857-32052879 GGCCCTTTAATTACGCACTGAGG + Intronic
1188862601 X:35274443-35274465 AGTCCTTTAATAATTGAGTAAGG - Intergenic
1190490826 X:50981492-50981514 AGCCTTTTAATAATTGAGTAAGG + Intergenic
1193707969 X:84845605-84845627 AGCCATTTAACAAGTCTCTAGGG + Intergenic
1195518430 X:105803612-105803634 TTCCCTTTAATAACTCAATATGG - Intergenic
1196835889 X:119813342-119813364 AGCTCTGTAAGAACTCACTATGG - Intergenic
1196837925 X:119830352-119830374 AGCTCTGTAAGAACTCACTATGG - Intergenic