ID: 1045379001

View in Genome Browser
Species Human (GRCh38)
Location 8:101604274-101604296
Sequence CAGCCCTTTAATAACTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045379001_1045379002 -6 Left 1045379001 8:101604274-101604296 CCTAGTGAGTTATTAAAGGGCTG No data
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045379001 Original CRISPR CAGCCCTTTAATAACTCACT AGG (reversed) Intronic