ID: 1045379001

View in Genome Browser
Species Human (GRCh38)
Location 8:101604274-101604296
Sequence CAGCCCTTTAATAACTCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045379001_1045379002 -6 Left 1045379001 8:101604274-101604296 CCTAGTGAGTTATTAAAGGGCTG 0: 1
1: 0
2: 2
3: 12
4: 122
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045379001 Original CRISPR CAGCCCTTTAATAACTCACT AGG (reversed) Intronic
905433418 1:37940907-37940929 CAGCCCTTAAGCAACTTACTTGG + Intronic
908449722 1:64240359-64240381 GAGCCCTCTAATAGCTCACAGGG - Intronic
909347068 1:74603021-74603043 CAGCCCTGTAATTATTCTCTTGG + Intronic
910381836 1:86634659-86634681 CAGCCTTTTAATAATTCACTGGG - Intergenic
912852360 1:113138069-113138091 TAGCCCTAAAATAGCTCACTGGG - Intergenic
916696967 1:167248168-167248190 GTGCCCTTTAAGAACTCAGTGGG + Intronic
919813290 1:201422350-201422372 CAGCCCTGGAAACACTCACTGGG - Intronic
921718320 1:218441995-218442017 CGGTCATATAATAACTCACTTGG - Exonic
921897354 1:220414368-220414390 CATCCCTATAATAACTCCATGGG - Intergenic
1070666970 10:78351817-78351839 CAGCACTGTAATTCCTCACTGGG - Intergenic
1071433579 10:85625894-85625916 CACCCCTTTTGGAACTCACTTGG + Intronic
1071788776 10:88932612-88932634 CAGCCCTTTATTAAGTCACTGGG + Intronic
1072362815 10:94676697-94676719 CTGCCCTTAAATGAGTCACTGGG + Intergenic
1075217228 10:120546453-120546475 AATTCCTTTAATAACTCGCTGGG + Intronic
1078537217 11:12184949-12184971 CGGCCTTTTCCTAACTCACTAGG - Intronic
1079537067 11:21527289-21527311 AAGCCCTTTAATCAGTCTCTAGG + Intronic
1080137354 11:28871166-28871188 CAGCCTTATAATATCTCACATGG + Intergenic
1081207218 11:40290598-40290620 CAGTTCTTTAATGACTCTCTGGG + Intronic
1086947375 11:92856456-92856478 CAGTTCTTAAATAACTCACTTGG + Intronic
1089644437 11:119869366-119869388 CCTCCCTTTACTAACCCACTTGG + Intergenic
1090663555 11:128899838-128899860 CTTCCCTTTAATACCTCGCTTGG - Exonic
1092302639 12:7266778-7266800 CAGCCCTTTAATGATTCTTTTGG - Intergenic
1092662756 12:10756251-10756273 AAGCCCTTCAACAACTCTCTAGG + Intergenic
1092902719 12:13074966-13074988 CAGCCACTTACTAACTCACATGG + Intronic
1093392831 12:18643760-18643782 ATGCCCTGTGATAACTCACTGGG - Intronic
1094879390 12:34700357-34700379 CAGCACTTTAATTATCCACTTGG - Intergenic
1094879578 12:34704272-34704294 AAGCGCTTTAATTACCCACTTGG - Intergenic
1098433402 12:70444656-70444678 CAGCCATTTAACAAGTCTCTAGG - Intergenic
1101319494 12:103661003-103661025 CAGACTTTAAATAACTCACTGGG + Intronic
1103672108 12:122625941-122625963 CCGCCCATTAATAACTTACAGGG + Intronic
1104213544 12:126713752-126713774 CGGCCTTTTGAGAACTCACTTGG + Intergenic
1104338907 12:127928892-127928914 CAGCCTTGTAATAACTCTATTGG + Intergenic
1106734698 13:32577385-32577407 AAGCCCTTTAACAAGTCTCTAGG - Intergenic
1108065488 13:46573271-46573293 CAGCCATTTATTCACTTACTCGG - Intronic
1112521548 13:100100095-100100117 GATCCTTTTAATAACTCCCTAGG + Intronic
1115840384 14:37462854-37462876 AAGCCCTTTAACAAGTCTCTAGG + Intronic
1119684075 14:76616391-76616413 CAGCCCTTTAATCACACGGTTGG + Intergenic
1119982527 14:79098079-79098101 AAGCCCTTTGAAAAGTCACTTGG + Intronic
1120908991 14:89648217-89648239 CAGCCTTGCAATTACTCACTAGG + Intergenic
1121169276 14:91839495-91839517 CTGCCCATTGGTAACTCACTTGG - Intronic
1123967633 15:25474902-25474924 CTGCCCTTTAAAATCTCCCTAGG + Intergenic
1132009129 15:98258906-98258928 CAGCCCTTCCAAATCTCACTTGG - Intergenic
1134155919 16:11843369-11843391 CAGCTCTTTAATCACTGCCTCGG - Intronic
1146774207 17:35597539-35597561 CAGTACTTTAATAAATCAGTGGG - Intronic
1150725135 17:67645439-67645461 CAGCCCTTGAGTAACAGACTGGG - Intronic
1151639412 17:75378489-75378511 CAGGCCTTTAATATCTAACAGGG + Intronic
1151842936 17:76630507-76630529 CAGCCCTTTCCTAACACCCTTGG - Intronic
1156646300 18:39166098-39166120 CAGCCCTTTAATCACATACTTGG - Intergenic
1156841149 18:41610921-41610943 CAGGACTGTAATACCTCACTGGG - Intergenic
1156974453 18:43200800-43200822 CAGTGCTAGAATAACTCACTTGG - Intergenic
1158114700 18:53982308-53982330 CAGCCATTTTATATCTTACTTGG - Intergenic
1167927882 19:52836452-52836474 CAGCCATTTAAGAACTGACTGGG + Intronic
931162313 2:59705316-59705338 AAGCCATTCAATAAATCACTAGG + Intergenic
937653672 2:124349776-124349798 CAGCCCTTTTTTAAATCATTGGG + Intronic
938154242 2:128916887-128916909 CATTCCTAGAATAACTCACTTGG + Intergenic
938682178 2:133703123-133703145 CAGGCCTTAAATAACTCATATGG + Intergenic
940619953 2:156099575-156099597 CAAGCCTTTTATATCTCACTAGG + Intergenic
942656727 2:178221403-178221425 CAGCTCTTTAATACGTGACTGGG + Intronic
943131997 2:183865388-183865410 TAGCCATTAAATAACTCACTGGG - Intergenic
943334334 2:186595652-186595674 CTGCCATTAAATAACTCTCTGGG - Intronic
946031709 2:216710679-216710701 CAGCCCTGTAATAACACAATCGG - Intergenic
948118876 2:235514288-235514310 AAGCCTTTAAATAGCTCACTAGG + Intronic
1170556667 20:17520351-17520373 CAGCCCTTTTTTAACTCAAATGG + Intronic
1170857441 20:20070178-20070200 CTTCGCTTTATTAACTCACTGGG + Intronic
1171721186 20:28564699-28564721 CAGCCCTTTAATTCTTTACTTGG - Intergenic
1171756882 20:29118860-29118882 CAGCCCTTTAATTCTTTACTTGG + Intergenic
1171785382 20:29459058-29459080 CAGCCCTTTAATTCTTTACTTGG - Intergenic
1171862932 20:30418127-30418149 CAGCCCTTTAATTCTTTACTTGG + Intergenic
1173893161 20:46529114-46529136 CAGTCATTTATTCACTCACTAGG + Intergenic
1179680055 21:43013309-43013331 CAGCTCTTTCAGAATTCACTGGG + Intronic
1179919025 21:44497315-44497337 CAGCCCTTTAGGCACTCACCTGG - Intergenic
1180643438 22:17318099-17318121 CAACACTTTAATAAATAACTTGG + Intergenic
1183793498 22:40095389-40095411 CACACCTTTTATACCTCACTTGG - Intronic
952184758 3:30956736-30956758 CAGCCTTTTCATAACTGGCTGGG - Intergenic
953624010 3:44555632-44555654 CAGCACTTTAAAATCTCAATTGG - Intronic
954898747 3:54000583-54000605 CATCCATTTATTAACTCAGTAGG + Intergenic
955528615 3:59848452-59848474 CAGACCTTTAATAGCTCTTTGGG + Intronic
955827402 3:62962886-62962908 CAGCACTTTACTGAATCACTTGG + Intergenic
959765446 3:110021895-110021917 GCACCCTTCAATAACTCACTGGG + Intergenic
959808918 3:110593054-110593076 AAGCCATTTAACAACTCTCTAGG - Intergenic
961399982 3:126633035-126633057 CAGCCCTTTAAAACCTTACATGG - Intronic
963359072 3:144247186-144247208 CATCCCTCTCATAACTCTCTGGG - Intergenic
964390282 3:156189493-156189515 CACCCCTTTAATGAAACACTGGG - Intronic
964998928 3:162926998-162927020 CACACCTTTATTAACACACTGGG + Intergenic
965250612 3:166339359-166339381 CTGCCCTTTATTAACTCAGCTGG + Intergenic
972672334 4:41225710-41225732 CTGCACTTTAAAAACTCCCTAGG + Intergenic
973142635 4:46787483-46787505 CAGCTCTTTCATACCTCATTTGG + Intronic
978848325 4:113302249-113302271 CATCTCTTTAATATTTCACTGGG - Intronic
980237282 4:130125191-130125213 CAGCCCTTTAAAAATTCAGTAGG - Intergenic
981948753 4:150380443-150380465 AAGCCCTGGAATAACTCCCTAGG - Intronic
982948989 4:161664575-161664597 AAGCCATTTAATAAGTCTCTAGG + Intronic
983035108 4:162854279-162854301 TTGCCCTTTATTAACTCACCAGG - Intergenic
983236792 4:165188819-165188841 AAGCCATTTAACAACTCTCTAGG + Intronic
985370510 4:189281085-189281107 CAGCCCTTTAATTATTTATTTGG - Intergenic
985578993 5:686868-686890 CAGCCCTTTGATAAGGCACTCGG - Intronic
985593839 5:778931-778953 CAGCCCTTTGATAAGGCACTCGG - Intergenic
986537423 5:8805348-8805370 CAGCCATTTAACAAATCTCTAGG - Intergenic
986987271 5:13513918-13513940 AAGCCATTTAATAAGTCTCTAGG - Intergenic
988426587 5:31072237-31072259 CAGCAATTTAATAACACAATTGG + Intergenic
993275461 5:85851066-85851088 CAACACTTTAATAAATCTCTAGG + Intergenic
996664913 5:126048034-126048056 CAGACCTTGAATTAATCACTTGG - Intergenic
997196519 5:131983930-131983952 CAGCCTTTTAACAGGTCACTTGG - Intronic
998530500 5:142880213-142880235 TTGCCCTGTAATAAATCACTAGG + Intronic
998873573 5:146576519-146576541 CAGCCATTTAACAAGTCTCTAGG + Intergenic
1000147129 5:158464514-158464536 CAGCCCTCTGATTACTCACTTGG + Intergenic
1000575155 5:162967507-162967529 AAGCCATTTAACAACTCTCTAGG + Intergenic
1009680203 6:66881861-66881883 CAGCCATTTAACAAATCTCTAGG + Intergenic
1012878048 6:104753223-104753245 CAGCGCTTTGGTATCTCACTGGG + Intronic
1013459909 6:110365111-110365133 CTGCCTTTGAATAACTCCCTGGG - Intergenic
1014087898 6:117369205-117369227 CTGCCCTTTGTTATCTCACTGGG + Intronic
1016643402 6:146377309-146377331 AAGCCATTTAATAAGTCTCTAGG - Intronic
1017308910 6:152954041-152954063 CAGCCCTGTAGTAGCTCAGTTGG - Intergenic
1017640581 6:156490138-156490160 AAGCCATTTAACAACTCTCTAGG - Intergenic
1017827998 6:158096670-158096692 CAGCCATTTAAAAATTCAATGGG - Exonic
1020827979 7:13055743-13055765 CAGCTCTTTCATAGCTGACTTGG - Intergenic
1021277756 7:18675784-18675806 CAGCCCTTTCATGACTTACAGGG + Intronic
1022611178 7:31875027-31875049 CATCCCTTTAATATCCCACTAGG + Intronic
1026384123 7:69828803-69828825 CAGCCATTTAAAAACTGTCTTGG + Intronic
1028131247 7:87176470-87176492 CTGCCCATTAATCACTAACTTGG - Intronic
1030064363 7:105648087-105648109 CAGCCCCTTACCAACTCACCTGG - Intronic
1035180124 7:157083378-157083400 CAGCAATTTAATAAGTCTCTAGG - Intergenic
1036191739 8:6677256-6677278 CAGGCCTTGAAGAACTGACTGGG - Intergenic
1042650075 8:71030754-71030776 AAACCCTTTAAAAAGTCACTTGG - Intergenic
1045379001 8:101604274-101604296 CAGCCCTTTAATAACTCACTAGG - Intronic
1045895676 8:107213488-107213510 CAGCCCTTTCATAGCTGACTTGG + Intergenic
1046519781 8:115309394-115309416 AAGCCATTCAATAACTCTCTAGG + Intergenic
1047044273 8:121034167-121034189 CTGCCCTTGAATTTCTCACTTGG - Intergenic
1048033110 8:130651608-130651630 AAGCCCTGTAATAACTTCCTAGG + Intergenic
1053449056 9:38178198-38178220 CAACTCTTTAATAACTTTCTTGG - Intergenic
1056595071 9:88001293-88001315 AAGCCCTTTAACAAGTCTCTAGG - Intergenic
1058541709 9:106018664-106018686 CAGCCCTAAATTAACTCACAGGG + Intergenic
1203446162 Un_GL000219v1:58288-58310 CAGCCCTTTAATTCTTTACTTGG - Intergenic
1187263019 X:17704631-17704653 CAGACCTTTGATGACTGACTGGG + Intronic
1189365749 X:40387246-40387268 CAGCCCTTCAATACTACACTTGG + Intergenic
1191040371 X:56071952-56071974 CAGCCTGTTAATAACTCATAAGG + Intergenic
1192661471 X:73046988-73047010 CAGCCCTTTCATCACCCAATGGG - Intergenic
1196074089 X:111555796-111555818 CAGCCCTTTAATCACATAGTTGG - Intergenic