ID: 1045379002

View in Genome Browser
Species Human (GRCh38)
Location 8:101604291-101604313
Sequence GGGCTGTGAGCTCAGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378996_1045379002 6 Left 1045378996 8:101604262-101604284 CCCACGCAAGACCCTAGTGAGTT 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045379000_1045379002 -5 Left 1045379000 8:101604273-101604295 CCCTAGTGAGTTATTAAAGGGCT 0: 1
1: 0
2: 1
3: 16
4: 121
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378994_1045379002 23 Left 1045378994 8:101604245-101604267 CCCTAAGATGAGGAATTCCCACG 0: 1
1: 0
2: 1
3: 5
4: 53
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378997_1045379002 5 Left 1045378997 8:101604263-101604285 CCACGCAAGACCCTAGTGAGTTA 0: 1
1: 0
2: 0
3: 0
4: 68
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378995_1045379002 22 Left 1045378995 8:101604246-101604268 CCTAAGATGAGGAATTCCCACGC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045379001_1045379002 -6 Left 1045379001 8:101604274-101604296 CCTAGTGAGTTATTAAAGGGCTG 0: 1
1: 0
2: 2
3: 12
4: 122
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045379002 Original CRISPR GGGCTGTGAGCTCAGATTCC TGG Intronic
No off target data available for this crispr