ID: 1045379002

View in Genome Browser
Species Human (GRCh38)
Location 8:101604291-101604313
Sequence GGGCTGTGAGCTCAGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045378994_1045379002 23 Left 1045378994 8:101604245-101604267 CCCTAAGATGAGGAATTCCCACG No data
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045379000_1045379002 -5 Left 1045379000 8:101604273-101604295 CCCTAGTGAGTTATTAAAGGGCT No data
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378996_1045379002 6 Left 1045378996 8:101604262-101604284 CCCACGCAAGACCCTAGTGAGTT No data
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378997_1045379002 5 Left 1045378997 8:101604263-101604285 CCACGCAAGACCCTAGTGAGTTA No data
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045378995_1045379002 22 Left 1045378995 8:101604246-101604268 CCTAAGATGAGGAATTCCCACGC No data
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data
1045379001_1045379002 -6 Left 1045379001 8:101604274-101604296 CCTAGTGAGTTATTAAAGGGCTG No data
Right 1045379002 8:101604291-101604313 GGGCTGTGAGCTCAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045379002 Original CRISPR GGGCTGTGAGCTCAGATTCC TGG Intronic