ID: 1045383824

View in Genome Browser
Species Human (GRCh38)
Location 8:101652114-101652136
Sequence GATCTGGGTGGGGTAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045383816_1045383824 -7 Left 1045383816 8:101652098-101652120 CCCTAAGTTTATTTGGGATCTGG 0: 1
1: 0
2: 3
3: 13
4: 175
Right 1045383824 8:101652114-101652136 GATCTGGGTGGGGTAAGAAAGGG No data
1045383813_1045383824 12 Left 1045383813 8:101652079-101652101 CCTGCTCACTGTAGTTGTACCCT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1045383824 8:101652114-101652136 GATCTGGGTGGGGTAAGAAAGGG No data
1045383818_1045383824 -8 Left 1045383818 8:101652099-101652121 CCTAAGTTTATTTGGGATCTGGG 0: 1
1: 0
2: 1
3: 18
4: 131
Right 1045383824 8:101652114-101652136 GATCTGGGTGGGGTAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045383824 Original CRISPR GATCTGGGTGGGGTAAGAAA GGG Intronic
No off target data available for this crispr