ID: 1045386634 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:101677432-101677454 |
| Sequence | CTATATACAATCTTGGAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045386634_1045386639 | 18 | Left | 1045386634 | 8:101677432-101677454 | CCTACCTCCAAGATTGTATATAG | No data | ||
| Right | 1045386639 | 8:101677473-101677495 | GCTGCCACTAAACACTGAACAGG | No data | ||||
| 1045386634_1045386638 | -4 | Left | 1045386634 | 8:101677432-101677454 | CCTACCTCCAAGATTGTATATAG | No data | ||
| Right | 1045386638 | 8:101677451-101677473 | ATAGTGCTTGGTTCTATGTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045386634 | Original CRISPR | CTATATACAATCTTGGAGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||