ID: 1045386634

View in Genome Browser
Species Human (GRCh38)
Location 8:101677432-101677454
Sequence CTATATACAATCTTGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045386634_1045386639 18 Left 1045386634 8:101677432-101677454 CCTACCTCCAAGATTGTATATAG No data
Right 1045386639 8:101677473-101677495 GCTGCCACTAAACACTGAACAGG No data
1045386634_1045386638 -4 Left 1045386634 8:101677432-101677454 CCTACCTCCAAGATTGTATATAG No data
Right 1045386638 8:101677451-101677473 ATAGTGCTTGGTTCTATGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045386634 Original CRISPR CTATATACAATCTTGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr