ID: 1045387482

View in Genome Browser
Species Human (GRCh38)
Location 8:101685850-101685872
Sequence TCTGATCCTGAGAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045387482_1045387486 6 Left 1045387482 8:101685850-101685872 CCAGCCACCTTCTCAGGATCAGA No data
Right 1045387486 8:101685879-101685901 TTATTCATGCTCAGGACTCATGG No data
1045387482_1045387489 24 Left 1045387482 8:101685850-101685872 CCAGCCACCTTCTCAGGATCAGA No data
Right 1045387489 8:101685897-101685919 CATGGTGTCAGGGCCATCACTGG No data
1045387482_1045387488 14 Left 1045387482 8:101685850-101685872 CCAGCCACCTTCTCAGGATCAGA No data
Right 1045387488 8:101685887-101685909 GCTCAGGACTCATGGTGTCAGGG No data
1045387482_1045387485 -2 Left 1045387482 8:101685850-101685872 CCAGCCACCTTCTCAGGATCAGA No data
Right 1045387485 8:101685871-101685893 GACTTGTGTTATTCATGCTCAGG No data
1045387482_1045387487 13 Left 1045387482 8:101685850-101685872 CCAGCCACCTTCTCAGGATCAGA No data
Right 1045387487 8:101685886-101685908 TGCTCAGGACTCATGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045387482 Original CRISPR TCTGATCCTGAGAAGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr